GenePrediction:GLEAN_4933 Details

Name: GLEAN_4933
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:534724..533558 (- strand)
Length: 1167
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:534724..534619 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_89:534564..533558 (- strand)
Length: 1007
>GLEAN_4933 class=GenePrediction position=GCSC_89:534724..533558 (- strand)
ATGGGGTCCGTTGGAATTGAAATGACACCTCTTCCCAAGCCTTTCCCTGGATCGGCCGTCGACTTTGGAGTCGAGCTATC
CGGAATCGACGTTGGAAATCTCACTGGTATGGGTTTCTATTCCCTCTTTGGTTGTTTCTATGGTACTAATGTCCTTGCAG
ATGACACATTTGCCATTATTCGCTCCGCTCTGTACCAACACAATGTAGTCTTGATCAAGAACCAGCACTCACTGTCTTCG
CGTGTTCAGTGCGAATTGACCTCTCGATTTGACCCAGACGCCAACGTTTACAGCCATGGAAAGAGCATCGACAAGCGGAG
TGTCCTGCACAAAGACTTGACGACCATCCCGTCTGAGCCCAAGGTCCAGGTGATCGGACACGGCTCTGTCAAGTCATTTG
AAGGGCTGGAGGATCTCAAGCTCACGCATCCGCATCACAAGAACTTTCACAGGCATCCGATCCCGGCCGAGGACGATCTC
CAGTACACACACTTTTACCGCTGGCATATCGACTCGGCCATGTATGATCTTGACCCTCCTCTGGTCACTTCGCTGTTCGC
AGCTAGCGTTCCCAAGGGAAGGCGCCAGATCTGTCGCTATGATGACGGCAGTGGAGAAGAGATGGAGCTTCCACTGGGCA
CAACGGCATTTGTCAGCGGCTACAGGATGTACGACTTGTTGTCCGAAGCAGACAAGGAGTTTGTCCGAACCAGCACAATC
GAATACGGGGCGCATCCATACATTTGGATGAGCAGGGCTAAATCCAGATCCAACGGACTCGGACTGCTGTCAGAAGGTCT
AGAGCTTCCCGATGACGAGCTCCCAGCCATCGAGTGGTCGAAGATCAGGCGGTATCCCATGGTCTGGAAGAATCCAGAGA
CTGGAAAACTTGCTATGATGGTGTACCCAACACCAGTCCGCAAGATTCATCTGCAGGATGGAACTGTGATGGATGAGCTG
GAACAGGTCAGAGAGACCATCTACCGTCTTCAGCGACCAGCCATCAGCCCCCAGTTTGTGCAGACAGTAGACTGGCAGGA
GGGCGACTTGGTGCTGTTCAACAACCACGGGCTTCTGCATTCTATCACTGGCGCGTTTGCAGAGAACGAGGTCCGTCTCT
TCCGGCAGTGCAACATGGCAGCAAGCAGGCCTCCTCTGGGCCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62