GenePrediction:GLEAN_4934 Details

Name: GLEAN_4934
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:524764..523486 (- strand)
Length: 1279
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:524764..524612 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_89:524484..523930 (- strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_89:523830..523486 (- strand)
Length: 345
>GLEAN_4934 class=GenePrediction position=GCSC_89:524764..523486 (- strand)
ATGATCACTGCCTCATTTCCCCGTCTTGCCGCAGAACGGCGCGAGCGTCGCACGAGGACGATGTCTGTCGCCCGTGTGGC
TGTCGCGAAAGACAACAACGACGGACATCGTCGCGAGAAGCACGTCCTTCCTCTTTCATCATCCCCCCGTCTTGTATCTC
TCCATCGCGTCACACTATCGCTATCGCGCAAGTCGCGCTCAGACCTAGCGCGTCGACTAGGGGCAAATGAAGAAAAGTAG
ATGAGAATGCGGTGCAAATCTGACACGCGAAAATGAGCAGTCTGCTATGGCTGAAACTGCTGAGCAGCAGCCCGATCTCC
TCACCGGCAGCCCGCCACAGAAAAGGAAGCGCGGCGGCGAGTCGGCCTCGCCAGACACACGTCGGTCGAAGCGGGGAGCG
TCAACGTCCAGCACGACAGGTCTGACGCAGGGCATCGAGCCTGCAGCCACTGCCTTTATGGAGGCGACCGGAACAGGCTC
AGCGGACGGACTGACGGCAGCCGAGTTCAGCGTGATCCAGGGCACCGGCGGTGTAGAGCACACGGACGCGACGAGCGCGG
CGCTGGCCTCGTCAACGGCAGCAGCGGCTCTGGGCTCGATGTACCCGACGCTGCACGTACCGCAGTCGACGGAGGAGACG
TTTGCCAGCCAGCAGATCGACGTAGGCGGCGATCCCCAGCAGCAGCAGCACCATCACGACCATCACGATCACCACGATCC
GTCAGCCTATGGCACAGACGTGACGGGCGTGCAGTCGGACGGGCTATCGGCCCTAGAAGCGAGCACAGCGGGCAGCAATG
GCATGGGGCCTAAACGACCAATCTCGGGCATTCAGGTGAAGCCAGCCGTCGGGACGGACGAGTGGCACAAGATGCGCAAG
GACAACCACAAGGAAGGTGTGTGTGTGTGTGTGCCTGTGTGTGTGTGTTAAAAGTATACGCCGACTGACAATATAGTGGA
ACGCCGACGTCGGGAGACGATCAACGAGGGCATCAACGAGCTGGCCAAGATTGTGCCAGGCTGCGAGAAGAACAAGGGGT
CAATCTTGCAGCGGGCGGTGGTCTTCATCACGCAGCTTAAGGAGAACGAGACGCAGAACATTGAGAAATGGACGCTGGAG
AAGCTGCTGACGGAGCAAGCGATCGCAGAGCTGTCGGCCTCCAATGATAAGCTCAAGGCCGAGGTGGAGCGACTGTATCG
CGAGCTGGAGACATGGAAGCGCGTGGCCCAGAACGCCGGCCTGCAGCCGCCGGAGGAGAAGTCGGAGCCGCCTAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62