GenePrediction:GLEAN_4935 Details

Name: GLEAN_4935
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:522852..522234 (- strand)
Length: 619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:522852..522773 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_89:522579..522234 (- strand)
Length: 346
>GLEAN_4935 class=GenePrediction position=GCSC_89:522852..522234 (- strand)
ATGTCGGCGAGATTGGGTCTGAATGCCGGCCCGGTCACGGTGATCAGGCAGGCGATGCGCATCGAGCAGCCAGATCCGGT
GTGAGGCCCAGATGAGACGATGTCGAGAGTTGGCAAGACTTTTTAGATGGGTTGGTCGCGTGGAACTGCCCAAACGGCAT
GGAGGTGCGACCATGTTGACGGCAGCGGTGGCGGTGTTCGGAACCGAAGGCAGGAAATCGCAGGGAGGCACCAATGGCAC
GAATTGACCCCAATTGGGCTGCCGATAAGAAAGGCCGGCGTCGCGATGGACTAAGACGCCGTCGGAAGCGGACAATGGCG
TCGACAGGCCCAAAGGGGCAGGTGCATGCGGCGAGGCGAGTAAATTCGCCGCCGCACAGCGCTGCAACCCACCGCAGCAT
CGCTCTTCTCCGCATCGACGAAGAACCCCTCAGCCCCTCTTCTGGACCATGGACAGGCGTCGGGCAGCCAATGAGAGCGA
CTGGCTAGCCGGCGAGTCACGGCCAGTGGAGGCAGGTGCTGCCGGTCGCTGTCCACAGCTGGGGCAGGTGCTACTGTCTA
CACCCCTCCGGCCGTTAAAAACGACAGAGCCCCCTCGCTTCGCCCTTCTTCTTGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62