GenePrediction:GLEAN_4938 Details

Name: GLEAN_4938
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:504448..503363 (- strand)
Length: 1086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:504448..504332 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_89:504255..504032 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_89:503981..503363 (- strand)
Length: 619
>GLEAN_4938 class=GenePrediction position=GCSC_89:504448..503363 (- strand)
ATGCGTCTGCTGCATGGCTGCCGGTCCCAGGCCGTCTGCACCGGGCTCGTCTTGCTGGGCTCGGCCTTGCAGCCGGTTGC
TGCCACCAGGCCCAAGAATGCCATTCTCCTGTCCGAGGTGAGCTGCGAAGAAGAAGAAGAAGAGAAGAAGAAAAAGAGAA
AAAGAGAAACACGACAAAGTCTGACTCCAACAGGTCCAGTCTCTCACCCTGCGTGCCGGCAAGATGACGTCCCATCGCCG
CGTATCGGCCGTGCCCCAGCTCTCGTGCACGTCCAGCCCGCCGGCTCTCTGCGACCTGCACACCGTCGACGTGATGCGCT
GCACCAACGAGGGTCCCGGCTACGACCACGAGGACATCCAGTGGTCCTGCACGGCTCAGCTGCCGCCCGAGCTCAAGGTC
TGGGCGCCACCGACGTCGTCTGCGAGGGCTATGCCTCGCGCGACGACCCCTACGTCCTGCGCGGCAGCTGTGCCGTCGAG
TACCGCCTGCTGCTGACCGACCTCGGCGATGAGCGATACCCCGATCTGGCTGCAGAAACAAGCGCCGGTGGTCTCGCTGG
TGCCGACTGGAGCTCCTGGCTGTTCTTCGGTCTCTTCGCCGCTGTCTGCATCTGGATCGTCTGGTCGGCCCTCACGGCCG
GTGGCCGCGATGACGAAGGACAGGCGAATGGTACACGACGGCCAGGTGGTGGTGGAGGTGGAGGAGGTCCCGGCTTTGAT
GGAGGTGGTGGTGGTGGTGGCTACGACTACGACAACGACCCACCGCCACCCTATCCCGGTAATCCCAAGCCGGAGTCGTC
CACGGCAGCTGCCCGGGCTGCTGGCCAGCAGTGGCGCCCAGGATTCTGGACCGGCATGGCTGGTGGTGCTGCAGCTACTT
ATCTGGCTGGGCGCAACAGCAACAACGGCAGCAGCAGCAGAAACAACTCCGGCTACGGCTACGATGGCCCCAGACAGCCT
GGTCGGGGATTTGGCCGCTCGGCTGGGCCGTCCTACCGATCACAGTCGCCCCAGAGACCGCTGACAAGATCCACATCGTC
TGCCCGTTACGAGGGCACCGGCTTTGGCTCCACGAGCCGTCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62