GenePrediction:GLEAN_4939 Details

Name: GLEAN_4939
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:499299..497132 (- strand)
Length: 2168
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:499299..499243 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_89:499168..497132 (- strand)
Length: 2037
>GLEAN_4939 class=GenePrediction position=GCSC_89:499299..497132 (- strand)
ATGAGTTCCATGCTGAAGAAGAAGGGCGGTCTCGCCTTTAAGCCCAAGGCGCCGGCGGTCCGACGAGCAGCCGTAGCAAC
AACAGCAGCAGCGCCTTTGGCTGCCAATCTGACTGCAAACACGACGACGAGGGCAAATTCGATTGCTCCTGCTCCTCAGG
AAGTCCTCCAGACAAGCCAAGCAGCGGCTACCACAGGGCCGGGGGTCAGCCCAAGACGCCGACCGCGCCCGAAGCTATCG
CCCCCGCAGCCACGACGTCATCATATGTTGCACAGACAGCAGAAAAAGAAGCGACGGCACGATCCCAAAGAGCTGCAGCC
CCCACACCACTATCACCCCCTGCAACCCAGAGACAGCCGGCAGCAGTGGCAGAATGGCCAGTCAGCCAGGCTGCGCCTGT
GGTCGTCACAGCTCCGGCAACTCTGCCCCCAACACCCCCACCAACACAGCCGACAGTCCGACAGACCAGAACACGACGCT
CGACGACGGCGGCTCCAGCTGCGGCCGAACGACAGGAGGAATCTATGACGCAGCGGACGCGCATCGCCATCAGCAGTCTG
CTGCAGAGCGAAGAGGCCGTGGTTGCAACAGGTGTAGTCCCCGCCGACGAGGCGGCCAGCATTGTCAGTCCTGCTCCCGC
AGTTGCGGAAATCGTCGCTCCGGCTGCAGGACGGAGGGGTCGTTCCAAGGCCAAAGCCGCTGCTTCTGATCCTGCTCCCG
TTGTGCCGACGGAAGGAGAGTCTGCTGGTGCTGCCGTGGCAGCGACTGCGCCGCCAGCAAGGAGACGCTACACGAGGCGA
AAGCCGGTCGGCAGTGCGGCGGCTGCAGCAGATGGACAGGAAGGAGGCGCCGAGGCCCAGGTGCGGCCACGAGCAAGCCG
GAAACGGTCAGCGACATCCGGGACTAGCGAAGGGCCAGCAGCCACGACAGTGGCAGTGACAGTACCGGCAGCGGCGAAGC
GGAGCCGTCGAGAGCGGGAGGTGACGCCGGAAGATGCGGAAACGCGCACGGTAGACCACCGGGAGCTGAAGATGGAGGAC
CTGACCAAGGACTTGCGAATCGGCAAGAAGTTCAGCCGGCACGACGAGCTGGTCGACCGCGAGCGCGAGAAGCGACGGCA
ATATCGGCTAGGCAAGAAGAACGGCACGGGCGGGACAGCAGCGATGGCGGTAGCGGGAAGCGGTGGCAGCAGCGAGACCG
GATCCGTGCTGGGGGTAGTAGGAGTGGGCAGCGAGACGGGCGGCGTCAACGGCGGGCAGGTGCGGATGTCGGACGCCGTG
GCTGCGGCAGCATCGGTCATGGCAGCAGCAGTCGGGCCCCGACGAGCAGGAGGAGCAGTGGGAGCATCAGCGGCCGGGCC
GCAGTTTGAGATCATCGACGGCAACATTGTGGTGAACCAGGCATCGCTGGTGCACGATCGACACGCGGCAGCAGCAGCAG
CAGCAGGCGAGCTGGAGGAGGTGGAGGAGAACGACTTTACGCGGCAGACAACGTCGAACACGTACCTGAAGCCGGGCAAG
CTGCGGGGGCCGAATGCGTGGACGGAAGCCGAGACGGAGCTCTTTTACCGGGCGCTCAGCATGTTTGGCACCAGCTTTGA
CCTGATCTGCAACATGTTTCCGGGCAAGTCGCGACGTCACATCAAGATGAAGTTCAACCGCGAGGACAAGCTGCGGCCGG
ATCGCATCACCGACGCGCTCGTCGGCCAGCACAAGGTGGCCATCGACGTGGACGAGTACATGGCGCGAACAGGCCAGACG
CTGCACGCGACCGAGACCATTGACGCCGAGTATGCCCAGCGCCAGGCCGAGCACGACGCCGAGCAGCAGCGCATCGCCGA
TGACGCCGCCGAGCTGCTGCGCAAGAAGCGTGAGGACTTGTTCAGGCCGCGCGGCAGTGCAGCTGGTGCTGGTGTCAAGA
CTGCGGCCGGACAGACAGCATCGCACAATCTCTCGGCACGAGACTTTGACCCTCTTGGTGGCGCTGGTAGTGGCCCCAAT
CCAGACGACGAGATCGACGAGACCGTTGAGGACGAGACCGACCTCGTTCGGCACAACGGCCGCCGGCGTCCTGCTGGCCG
CTCCAGGGTCGGAGGCATGAAAGCCGCCGTGGCCAGTGGCTTCGGCGAGGCCTACGACAGAATTGGCGTTTGTGTGTACA
GAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62