GenePrediction:GLEAN_493 Details

Name: GLEAN_493
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:152195..154420 (+ strand)
Length: 2226
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:152195..153696 (+ strand)
Length: 1502
Type: CDS
Source: GLEAN
Position: GCSC_97:153754..154420 (+ strand)
Length: 667
>GLEAN_493 class=GenePrediction position=GCSC_97:152195..154420 (+ strand)
ATGGGTGTCGGACGGCGCATGGGAAAGAAGCAGGGTGCTCCCGAACCCCTGTCGGAGGAGCACTTTGCGAAGCTGAAGAG
AAAGGCCGGTCTGCCAGTGGACACTCCCTCGCAGGATGACGGGCCGTTGTCGAAGCGTCGGCGAGGCAACAAGGGCGAGA
AGGTTGAGAAGAAGGCAGCAGCAGCAGCTCCAGTGGCTAAGGCAGCAAGTGGCCGGAAGGCCAAGAAGGCAGCGTCGCCA
CCACCGGTGTCGAGCTCAGACTCGGATTCAGAGATGGAGTCGAACGAGTCTGGAGCAGAGATGGGCGGACGTCAGCCGAT
GCCGGGGTTTGGAGACAGCGACGACGACTCGGACGTGTTCGATTCGGACGCGGAGCAGGAAGGCAAAGGGGGGGCGTTTG
TGTTCTCGGACGACGAGGACGACTCGGAAGTGGAAGAGCGGCTGACAGCAGCCAACATTGAGGGTCTGTCGCGCAAGCTG
GACCAGAAGCAGGCACGCGAGGCGGCCGAGGCCGAGGCTGAGCTGCGAGACAGCGCGCTGCAGACGAACATTGGAGGTCT
GGGCGGATCCGAGGACGGGTCCGAGGCCGATTCCGATGCAGAGGAGGACGACGGGCCAGCAGGCGCCAAGCGGCCCAAGT
CGCAGCTGGCGCCAGACCTGCAGCTGCTGCGCAACCGGATCGGCGAGACGATCCAGGCGCTAGAGGACTTTGGACGACTG
GGCGACAAGGCACGGCCGCGTGCCGACTACGTGGCGCAGCTGGTCCGGGACATGTGTTCGTACTACGGCTACTCCGAGTA
CCTGGCCGACAAGCTGTTCCGGCTCTTCCCGCCGCGCGAGGCGTTTGCCTTTTTCGAGGCCAACGAGACACCGCGGCCAG
TTGTCCTGCGGACGAACACGCTCAAGACACACAGGCGCGAGCTGGCCCAGGCGCTCATCAACCGCGGCGTCACGCTCGAG
CCGGTCGGCCGCTGGTCCAAGGTCGGGCTGCAGGTGTTTGAGAGCAACGTGCCGCTCGGCGCCACGCCCGAATACCTGGC
CGGCCACTACATCTTGCAGGCGGCCTCGTCCTTTCTGCCCGTCATGGCACTCGCACCCCAGGAACACGAACGCGTGCTCG
ACATGGCCGCTGCGCCCGGCGGCAAGACCACCCACATGGCCGCGCTCATGAAGAACACCGGCGTCGTCTTTGCCAATGAC
CCCAGCAAGGCCCGGTCCAAGGGTCTCATCGGCAACATTCACCGTCTTGGCGCCCGCAACGTCATCGTCTGCAACTACGA
CGCCCGCGACTTTCCCCGCGTCATCGGCGGCTTCGACCGCGTCCTGCTCGACGCTCCCTGCTCCGGTACGGGCGTCATCG
CCAAGGACCCCAGCGTCAAGACCAACAAGACCGAAAAGGACTTTATGCAGCTGCCCCATGTCCAGAAACAGCTGCTGCTG
GCGGCCATCGACTCCGTCAACCATGCCAGCAAGACGGGCGGATATCTGGTCTATTCCACCTGGTCAGTCTCTCTTCCCTT
CCCCTTTTTTTTCCCTCTCTCCTCTCCCTAACATCACAGCTCCGTCACGGTCGAGGAGAACGAGGCCGTCGTGGCCTACG
CCCTCAAGCGGCGCCCCAACGTCCGCCTCGTCGAGACCGGCCTGCCCTTTGGCAAGGAGGGCTTCACCAGCATCATGGGC
AAGACCTTTGATCCCACCCTCAAGATGACCCGCCGCTTTTATCCCCATCATCAGAACGTCGACGGCTTCTTTGTCGCCAA
GCTGCAAAAGTTTGCTCCCACCCCGGCCAACGCTGTGCGCGCCGAAGGATCCAGTGCTTCACGTTCCCAGACCGCCGAGA
CTGCTGACCATGCCGGCAACACTGACAACGACAACGACAACGCCCCCATCGCCGTCACCGACGACAGCGACGCCGCCACC
GACAAGGACGACGGCGCTGACTTTGGCGGCTTCGACGACGACGAGGACGCCAAGTACATGGAGCGCGCCCGCAAAAACGC
CATGCGCCGTCGCGGACTCGACCCCCACATGCTGCACCGCAAGCCCGCCAGCAAGGACGAGGACAAGACCGTTGCCCTCG
ATGCTTCCCAGCCTGATGCCTCTCCTGCAGATACTCCGACTGCTGCACCTTCTACTCCGGCGGCTGCTCCGACCACTGCT
CCGTCCAAGAACGGACGCGCAAAAACACAAAAAGCACAGGGCAAGAAGGCCGACAGGAAAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62