GenePrediction:GLEAN_4940 Details

Name: GLEAN_4940
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:486394..482714 (- strand)
Length: 3681
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:486394..486212 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_89:486144..486101 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_89:486021..485880 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_89:485814..485711 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_89:485641..485593 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_89:485528..485151 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_89:485005..484936 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_89:484877..484841 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_89:484778..482714 (- strand)
Length: 2065
>GLEAN_4940 class=GenePrediction position=GCSC_89:486394..482714 (- strand)
ATGGTCTCCTTCCGGACTCTCCTTACCGCCTTGGGCGCTGTCGGGGCTGCTTTTGCTAGCACTGACGGCCTCACTGACCT
TGTCACGTGGGACAACTTCAGCCTTAGCATCAACGGAACTCGTGTTTTTATCCAGTCGGCCGAGTTCCACTACCAGCGAC
TGCCTGTCCCAGATTTGTGGCCGGTTCGTAACAAGCCTGTCTCTATGGAAGTAGAGGAGGATGAAACCCAGCGCTGATGT
GGTCTTGTAGGATGTCTTCCAAAAGTTCAAAGCCAACGGTTTCAATACGATCAGGTGAGTGTCCTGTTCTGGAAGGAACG
CCGGATCGGTCTTTCTGTGCTTCCGATTCTGCGCCTAACATGCGGCTCTTCAGCATATATTTCTTCTGGTCGTATCATTC
CGCCTCGAAGGGTGTTTTCGATTTTGAAAGCCCCGGAAAAGACGTCCAGCGCCTTCTTGATGCCGCCAAAGATGCCGGCC
TCTGGGTGATTGCCCGTGCAGGGCCTTACTGTAATGTGAGTCTTGATGATAATACATGAGATGTTTTCATTGCTGATTCG
TGCTTAATGCTGCTTGCTAGGCCGAGACCAATGGCGGATCGTTGGCTCTTTGGGGCTCTGACGGCAGCCTTGGCCGGATG
CGGACAAGTGACGAGACATACCACCAAGCCTGGTTGCCATGGGTGTACGATAATCGATCCTCACTTGTCAAACAATGACC
GGATGGTGCATGATAGGGCTGATACAACCGCAGATCTAAAATAGGCGCTTTGATCGCGAAGAACCAGATTACCAACGGTG
GCGTACGTATCTGAATTCGGGGTTTGCAGCAATGTCTTGAAACAAGCTGACCCATCATATCTACAGCCTGTCATCCTCAA
CCAGGTTGAGAATGAGTTTGTGGAGAGTGTTCATTCTGCGAACAGCACACAGGTCCTGTATATGGAGCAACTGAAAACCG
CCTTCCGAGATGCCGGCGTCATTGTGCCTTTCACGCATAACGAGAAGGGCATGCGTGCGAACTCGTGGTCAACCGACTAC
GAGAATGTTGGTGGCGCTGTCAACGTCTATGGTCTTGACAGCTACCCCGGCGGGCTCTCGTGCACAAATGTCAACACTGG
ATTCAACGTCGTTCGAACCTACTACCAGTGGTTCCAAAAATATGCACCATCCCAGCCCATATCAATTCCCGAGTTTGAGG
GCGGCTGGTTCTCAGCCTGGGGAGATTCTGCATTTTACGATGATGTGAGCCTTGCACTCCCTGGCGGATACTAGTGCTCT
AGCTGACAAGAGAAGTGTACTACAGAGCATTCTCCCGCGTTCGCGGATGTTTACTACAAGGTACAGCTCTCATAGTTGCC
TTGGGAAACGCAACATGCTAACGACACAGAACAATGTTGGCCAGCGGGTGACCTCTCAAAACATCTACATGACCTTTGGC
GGAACGAATTGGGGCCACTGTAAGCAGCTGCCGTCAGGGCCAGAACAACAGAGGTCCACATGCTAACAGCTTTGCAGCCG
CTGCTCCTGTCGTCTATACGAGCTATGACTACAGGTGAGAAGTGACACAACAGGCACGTTGACAAAAAACGGTCGCTTAC
CACCCCGTACTTACAGTGCCCCGTTGCGCGAGACGCGCCAGCAGACGACAAAGCTGTTCCAGACCAAACTGATCAACATG
TTCGACACCTCGTCACCGGACCTTCTCAAGACCGTCATGGTAGGGAACGGCACTGGTTTCCATCTATCGTCGAAGGCGCT
CTTCAGCTGGGTCCTACAGAACCCGGACACCGGTGCTACCTTTACCGTCATCCAGCAGAGCAGCACACCATCCACGAGCA
ACGTCACTGCCTCAGCCACCCTGAACACGAGCGCAGGTAGCGTTGTTGTTCCAGACGTCGCTTTGTATGGCCGACAGAGC
AAGATACTGGTGACAGACTATCTCTTGGGCGGTGGCGCCGGCTCCAACAACAACACCATTCTGTACTGTTCAGCCGATAT
CGCCACCAGCAGCACGTTCGGATCGGCAGACGTGCTTGTCCTCTACCTGAAAGAGGGCCAAACTGGCGAATTCTCCTTCC
GAGACACAGCCAATCTGACATTCACCGTTTACGGCAACTCCCAGGTGACCGCAAACTCTTCTTCTCACCAAAGCTTCACG
TATGTGCAAGACTCTGGCGCCACAGCCGTCGTCTTTTCCAACAAAGTGATCGTTTACTTGCTCGACCAGCCGACAGCATG
GCGCTTCTGGGCGCCGGCCAACGGGAAGCCACAGAGCAGCCCGCTCGAGGTCTTCAAGAGCGACCGCCTTTTCATTCTGG
GGCCGTACCTGGTGCGTTCGGCCGAGGTAGACTGGTCCAAAGGCACGTTATCTATCGTCGGCGACAGCGATGCGGTTACA
ACGTTGGAGGCGTTTGTTGGGTTTGGTCCCCAAGACAGTAGTAGCGGCAGCTACACAACCATCCACACGATCGAGTGGAA
CGGACAAGCCTTGACAGCCGAGCGCACGGCATACGGGGCCTACCGTGCAAAAATCCCTGGCGGTGCAGATCTCTGGACCG
CCGCCCAGATCCCATCGCTGAAAGACGCCACCTGGTATGTGGCCGACTCACTGCCCGAAGCGGACCCGTCATACGACGAC
AGCCGGTGGGTGGTCTGCAACAAGACGACGACAGCGAGCCCTTCAGCGCCAAGAACGCTTCCAGTGCTCTTCAGTTCTGA
CTACGGCTTTTATGCAGGCACCAAGGTGTACCGGGGCCGGTTTTCCTTTGATGAGCTTGAGAGTGCGCCCACGGCGGTCA
ATCTCACAGCGTCAGGCGGCGTCGGCTTTGGCTGGACGGCATGGCTCAACGGCCAGCTTCTGGGCGGCGATGTCGGCACC
GCATCTCTGGGCACGTCGTCGGCGGAGCTGGCGCTGACCGCCTCGTCGCTTCTTGAGTCGGATGAAGGCGACAACGTGCT
GACCGTGCTCGTGGACTACCACGGACATGACGAGGAGAATGTGGCGCACGGCCTGGAGAATCCCCGGGGTCTACTGGGAG
CACAGCTGCTATACGGCGACAACGAGGTCAGCAACGGCAGCTATACGGGCTTCTCGTCGTGGCGGCTGACGGGCAACGCC
GGCGGTCCTGCAAACATCGATGCGGTGCGCGGTCCGATGAACGAGGGGGGTCTGTATGCGGAGCGGCTGGGCTGGCATCT
GCCCGGGTTTGACGCAGCATCGGACACGGCCTTCCAGCTAGGCAGCCCCCTCGACAGCAACAGCAGCAACGGCGCGGGCG
TGCGGTTCTACGTGACGACATTCCAGCTGAACGGCGGCAAAGGCCTGGACCCGTCGTTGGACGTGCCGCTGGGGATCCAG
TTTGCGGCCCCGACAGACACGATGGCCCGCGTCATGCTGTGGATCAATGGCTATCAGTACGGCAAGTATGTGCCGCACCT
GGGCCCACAGACGCGGTTCCCGGTGCCGCCGGGCATCCTGAATGTGGGTGCGGGCGAGAACAACACGCTGGCGATTAGCG
TGTGGGCTATGACCGAGGACGGGGCGACGCTGTCGGAGGTGTCGTTGGTGGACTATGATGGCGCGTACGAGACGGGCTAT
TCGGCAGCGGCGACGGGTGGCGATGCTGCTTCGCGCGAGGCGCTGCAGCCGAAGTGGACAAACCGGGCGAAGTATGCATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62