GenePrediction:GLEAN_4941 Details

Name: GLEAN_4941
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:479525..478280 (- strand)
Length: 1246
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:479525..478959 (- strand)
Length: 567
Type: CDS
Source: GLEAN
Position: GCSC_89:478895..478465 (- strand)
Length: 431
Type: CDS
Source: GLEAN
Position: GCSC_89:478292..478280 (- strand)
Length: 13
>GLEAN_4941 class=GenePrediction position=GCSC_89:479525..478280 (- strand)
ATGGGATCGACAGCCCCGCCAGCCGCTGCATCGATTTCGTGCATGCCGATCCCCCAAAGGACGATGACTTGCAGTGCACC
AACAAAGCGCAATTTCCGGGTGCTCCTCCGGCCTCTGAACATCATTGTTCTCTCTCTCATCCTGGCCGTTCTCCTCCCGG
TCGCCGCAGCTAACACAGCCGACCCGATCCCGCTCGCCTCCAATTCGAATTTCAAACCCACAGCCACGCTGTCTCCCGGG
ACCACTGAGACCTTTATTCGCGACAATCGCGTGCCAGTGAAGCAAAATGGACGCTGGGTCTATCTCTCGGACGGGAAGGT
CGACGACCTGCGAAGGCGCGTCGATACTGCGACTGATTCCAGTACCAGCGCAAAAACTACAACAACAAAAACGACGAGCA
AGAAGACCACATCCACCTCTACCGCCTCGTCCAGCGCGCTCCCCGAATTTTTTGATAGCAGCCTGGCCTCCAATTACTCG
AGCAGTGGCAACTGCCCTACTTTTATCAAGTCATTCATCTCAAACTCCACCTTTACAAAGTGCTATCCATTTTCATTGCT
TCTTGAGGTAAGCTCATCCCGCAGGAACCAGCCGATGCAAAAGACCGGCTCGCTAACTATCGATACACAGGGCTCTACCT
CCTTCTTCAATGCGGAGAAGTCGCTAGTGTCTATCACACAGGTGCTTGACGCTTCATGCGCGGCCAACGTCACGTTTTGC
GCAAATTATCTGGACAACTTAGCAACGGACCTGATTAGCTCAGACAACTGTGGAGACGACTACAATCTGGGCAACTCAGT
TGTCCATGAAGCCTATCTAGGCATGCAGTCCTACCAGGTGCTCTATTCGGCAACGTGCCTGAAAGACTCGGCTTCAAGCC
AATACTGCTTTGCCAATGCGATCACAAACCTCACAACGACGGCAAACGCATATTTTTACTATCTTCCTCTCAACATCTCT
CTACCCGGGAGCTCGATGCCATCATGCAACACATGCCTAAAGAACACCATGGCAGTCTTCCGGGCCGCCTCCATAGACCG
CAATCAACCGATCGCCAACACGTATGTGTCAGCTGCCCAGCAAGTGGATGAATTGTGCGGTCCGAATTTTGCAAACGATA
CCTTGCCGGTCTCGTCATCTGCAAGCTCTTTTTTGCGAACTTCGCGATCGTGGCCATGGCTTGCCTCATTGTTACCAGCT
TTGATAGCATATTCGCTGTTATGACAAGCGTAGTCTTTGGGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62