GenePrediction:GLEAN_4943 Details

Name: GLEAN_4943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:462953..460613 (- strand)
Length: 2341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:462953..462840 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_89:462775..462690 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_89:462533..462328 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_89:461946..461900 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_89:461807..461723 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_89:461658..461384 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_89:461320..460613 (- strand)
Length: 708
>GLEAN_4943 class=GenePrediction position=GCSC_89:462953..460613 (- strand)
ATGGTGGCGGGAGAGGAGCCTGTGTTAGGAGCTGGAAAGGCAGTTGCAGCATCTTTGATCAACATCGTGTGCGGTGCCTT
CGGTCTGCTTCGCTGTGAGGGCAACGACGAGACTGTCATTGATACCTTTGGGGGGGCATGTTCGATTGCGTCTCTTTTGT
CTCGATCTTCCGCTGCAGCCGCTTATCGTCCGGCAGACTGGTGTCGAGATCGCCCAGGATTGCAGCCACGAGTCGCCGCT
CCGGCTGGTTGAAAGTCACCGCAGGTAGTGGCATGTCTGCCTCATAACGGCCAAGCAAGCAGCTGCTTGCCGAGTTACGG
CTCGTTCTTCAAGTCAAGTAGTGGCGACGAGTGCTCTCCGCCACCTTGTGCCTGTGTGCTGGCTTTTCCCCAGCCTGCTG
CTAAGTGCGCCTGGCTATAGCGGTAAGAACGGTCGACAGCGTGCTTATCTCGTCGTCCAGCTGTCGTACCTTGGCATTCG
GACCAATGACCGGATCATCTCGTCGGTGACCCCTATTGACGCATCTTCGTCGATCTGTATCTTGAGCTGGTTGGAAGGCA
AGATATGGCAATCTGCTACCGTGACCGAGGAAGACGACCTGGGTCACGACATTCGTCCGAGCCGTTGTTCATGAAGGTAG
GCAAATTGTTAGAGACTTACTGTCGATGGCTTCGATGCTACTAAGGCGATAATTGTAGCTTCGCGGAACAATTGTGGAAT
TGGCCCCGTGTGAGAGGCTGCTCTGATATGACGTAGCCGTCCGGCGACTTGACGGACTTTACAAGGGGCACTACGAGCTC
GAGCTACACAGTGTGCAAGTTTAGCACTGTTCACGAAAACACGGCCAGTACGGAGTACGAATGCGGAAAAGCGGGACATT
ACGAGTACGAAACGTTTGCGACGCAGCGGGAGCTGGACGTTGGCCGATCCATCTAGGCAGCCCTCGTCTGACTGCCTCTT
ACGCATTCAAGTAAGGCTGAACAAACATCGAATACAATCCAGTACAGGCCAACGGCAGCGTGTACGTGATTTCGCCGAAA
CCATGGGCTGGACGGTGAGTGTTTGCACCTGGACGTCTTGTCCTGCTAAGAGAGCTGTCCGAATGACGAGGGGATGGCAA
CGTTTGACTGACAGCAATGACAACAGGTCTTTCGGATACTGGGGGACTGCGTCCACCTGCTGTCCAAATGCATCCTCATG
TTCGCCATCCACCGCAATCGGAGCGCCGAGGGTAAGAAGTGCCCCTTCTGACGAAGAAGCTGTCGTCGGCAAAAGCTGAC
TGGCCACGGTTACAGGCATCTCTCTCATCACGCAGATCCTCTATGCCGTTATATTCTGCACCCGGTACCTTGATGTTTTC
AGTGAGACGAGCTCCTGGAATCTGTTCTTCAAGATTTTCTACATTGTTTCGTCGTTTTATATTATTGCTATTATGAAATG
GGTCTATCCGCGCTCGCGCGAGAAGGAACTGGCCTGGAAGATGGGCGCCACCATCACTCTTGGATCGCTGCTCATCTCTC
CGTTCGGAATGATGATCTTTGAAAGCAAACGAATCTGGAGCTTCCGATCGGTGCGTCGCCCTTGTTCTGATGCTTGCCGT
GTATGGCCTTGCAAGCTGATGCCTTCGATCTAGTTTCTGTGGTCCTTTTCCGAGATTCTCGAGTCCGTGGCCGTTTTGCC
CCAGCTGCTGCTTCTACGACAGACGACCGTGCCGACCGTCATCGACTCCTTTTACCTGCTCGCTCTCGGCTCCTACCGCG
GCCTCTACATTCTCAACTGGATACAGCGCGCGGCTGGCCCGTCCGGCCGGAAACCTAACGGATTGTCCGTCACGTTTGGC
ATCATTCAGACACTCTTCTACCTCGACTTTGCCTGGGTCTACTGGACGCGTCAGCGGGTCAAGCTCCGCAACGGCGGCGT
TGTGGACGCCGACGACATCCGCCATGGCTGGCTGATCAACCGCGTTCTCGGCAAACACGTTGACCAGTCGGGCCACGACG
ACGAGGAGAGTGCGCCGGCGCTCGGAGGCCGGGGCGGCAGTGAAAGCAGCAGTGGGGGGACCGGTTCTCGGTGGGGAGTC
CGTGGCATCTCTGTCAGTGCCGACGACGCTACACTCGAGCACGAGGGCGAGGATGAGCATCTCTTCGCGGCCGAACGGTC
CGACGGTCACCACAACCTGGATGCCAGCGTAGACCCGGACGCCAAGATGCAGGACCCAGATGAGCTTGCCCGGGCCCTCG
ACGACGATGACGAAGACGACGACGATACCCCACCTTTGGCGCCCCGGAAGGACCGTGAAGGCGAGGCTAGTGGTGTCCGG
AATGATGAATGGGCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62