GenePrediction:GLEAN_4945 Details

Name: GLEAN_4945
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:454682..449502 (- strand)
Length: 5181
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:454682..453024 (- strand)
Length: 1659
Type: CDS
Source: GLEAN
Position: GCSC_89:452882..449502 (- strand)
Length: 3381
>GLEAN_4945 class=GenePrediction position=GCSC_89:454682..449502 (- strand)
ATGCTGCCCGTCATCATTTTCGCCAGCCTCATCTGGCTGTTCACCCTCCTCCGCCCGGAGACACGCCCGGCAGCTCAGGT
CCTTTGGCCAACTGCCATCGGATACCTCTTCCTCCCGGGCTGCCTCTTCCTGGTGGTGCCGGCCTCGATGTTCTTGCGGG
GTTTGTGGTCTGGCCGTGTTTTCCCTCGCCTCCACTTGCTCATTTCCTTCGCCGCAACCTCCGCCGCACTCGCTGTCCTC
TACGTTCTCTATCGCCAGCTCTCCTGGGCCACCGGTCTGACCATGGCCCTTGTCCAAGACTGGGAGGAGTTCGTTGTGGA
CGTGGCGGAGGGGCCTCGCGAGACTCTTGGCCCGCTCTTCCGTGACGCCTTCTTCGCCGGCCTCGACGACCTCAACTTTT
TTGAGGGACTCAAGCAGGACAAGCGGGATCTGCAGGACATGGCCGATCGGGCTCTCGACGCCCTGTTCGTGCTGCCGGGA
GTGATTGGCCACGTTTTCCACGCCGTCCTCTCTGTCCCCCGCTTCCTGATGGCCTGCGAAGACGCGCTCGACGAGGGCCC
CCTTGTGGTGGCGACGTTTGTTTGGGAGCACCTCCTGGCTTTGGTGGCCTTTGTCGTTGGGCTTCTGCTCATCGCCATGG
GCAGCTGCTGGCTCTACTTCATTCTCGTCCAGAAGAGAGCCCTGGAGATTGCCCACCGGCGGTCCCAGAACGAGCAGTTT
GTTGCTGTGATCGACCAGCAGCACGCCATGATCAACGCCATGGATGAAGTTGCCGACCAACTGTACCAGCGCGCCAAGTC
TGTCGTCGATGACATCTGGTACAATGTCTTCCGCCCGGGCGCCCTCCATCACCTGGCCCAGCTCCAGCATGCCTGCGTGC
CCCGATCGATGGGGTCGCGCATCCGCACCACCCGGCGCAACACCACGCACTTTGTGCGTCACCGTGTGGCGGTGCGGCCT
GGACTGGGCATGCCAACACCGGCTGCTCTCGCGACTTCCTTTGACCCGTTTGCCATTTACGACGCGCTGAATGATCTGTC
CGACTCCAACCAGCTGATCATGAAGGGACTTGCCTCGGAGAGAGGGAGGCTGGCCAGACAGATTTCCGCGCTGGACCAGT
ATCTCGAGGCAATCCTGGCTGACATCAAGCTGCATCTTCAGCGCGGGCAATACGGACGGGAGTCGTGGACGCAGGAGAAA
TATCAGGCAGCATTCGCGCGCTATGACGAGTACGTCATGCGCAAGGCCGACAGCGACAACGACAGCAATGCTCCTGATAT
TGGCTCCTTTGAGCAGTTTCAACTGGCATGGAACAGCCGGGCCGCCATGGTTTCCTCGCCGCCCGCTGTGTCCCGGGGAT
GTGCCAATGAATGGGCCTCATCCATCTTGCTCGACCACTCGACAGTCATCGTGCCTCGCGACGATCGCCAGTGGGATGAA
GATGCGCGACTGCACACGTCTCAGCAGCGGCATCGGAGTCCCCACGTCCGGATCGATGACCACCTGCAGCGTCCAGAGTA
TCGACTCCGCTTGCAGGACGAGCAGATGGAGAGCCAGCGCCTCGAGCTCTCGAGTGCCCTTCAACGGCAGCGGGCCATGG
AGAGCCACCTCCACGCCCTCGAGCAGAAGTGCAGCCAGCAGCAAAGCATTCTGGAACGGGTCCATCAGCAAGGACCCCCT
GAGTCGTCACCCACCGCGGCACGGCAGGAGGAGGACCGCCAGGGAGAAGCCTGGGAGCAAGATTGGTGGTAGCAGCACCA
TCTGCACCTGGACCGCCTCCCCTCGCCCCCTCCTCGCCAGCCGCCCCGGGAAGCTCAGGCCGAGTCGGCTTCGTCGGATG
CTCCTGTCAGAGGTCCGACGACCACACCGTTCCAGGAGGCAGCTGCTCTGCCTTCTGCTCCGATTCAGCACGACGGGACG
TCTGTCCCCCCCTCTGCCCCCGATCCAGCATTGAAGCTGTTTCGCCAGCGGCAGCAGGACTGGGCACTTTACCTGCGGAT
CGTCCGTGGAAAGGCCTCTGGCAGTCCCCAGCTCCCCGAGGAGCATGGCACTGTCGACGCCGGACCATCGAAACGGACGA
TGATCCCAAGGGCCGGTGCAAAGACAGCGTCCCCCGTCGCTCGCTCCCGTCGCCGTGTTCATTTCGCAGACACGTGCGAC
ATTCTTTACTTCTCGACTTCTCCGTCTTCCTCGCCCGACGCCGACGCCGACAAGATGCTGCTGGATTCTCCAGACCGGGA
GGACCAGCATGCAGCAGAGCGGGAATTCCAACGTCTGGAAGACCTCCCACCTCTGCCCTTGTCTCCGCCACCGCCGCCAC
CGCAGTCGTCCACCGAAGACGTACCGCCACTGCCGCCATTTCCGTCCGGCCGGAAGAAGATGGACAAGTCGACGAAGCGA
GAGGTCTTGGCATCTCCCGCGACCATTTCGTCACCAGCCCCCACCGCCGCCGCCGCTTTGCCAGTCACGTCGGAGCCACT
GCACGTGCATGAGACAACACACGACTTGTGTTCGTCTCGCTTTCTGCCGAGCCGTCATCGCGCTCAAGAACCCACTTCCA
GGGTGCTGAGGCAGCGAACACGGCAGACGCAGAGAGTGCAGCGGACGCCGCCATCGCAGCGTCCGCTGCATGCACGCAGG
GTCGACGTCGACGAGCGGTCGGCACAGGAGGTCCGGAAGCAGGACCAGATTGGACTCGCGGGAGAATCGACGCCAGACTC
TCCCCCACACATGTCGCAGCAGGCCGCCACCCCGGCTGCGACCCCCACATCCCCTGCCCAGTTGTTGCCCGGGAATGCCC
CATCCCCAGCACCGGTGATGCATTATATCCCGGGAGCTATGCCCGCCGGAAGTGGAAGTGAGGACGACTTGTTCGTTCTC
GCGAAGCAGCGGACGGTGGAGGCCCCGATGGCGAAGGCTCCGAGTGCAGCAGCAGGTGCAGGGATGCACTCGATGGAATC
CGATCCGGGAGCATCGGACATCGACATGACGACGGCCATGGACTTTGAATGGCACGCGGCTACAGAAGCCGCCACGGACG
AGGAGGCCGAGATCATGGCACAGCTGGCATCGACGATGGCGTCCACGGACCTGTCTGACGTGCTGGCGCCACCTCTGGCC
GAATCGTTTGCGGAGACCGGCGAGGTGCAGCACACGCTCCCTCTCCTGGAAGACCAGATGGCAGCGCTCGATGTCTGGAG
CCTGCCATGCGACAATCTGCCGGACATGCGGGAGGTACTGGGCCTCACAGAGTGGCCCACGGACGAGGAGATGACGGAGC
TGAGGGAGATCCTTGACAGGGCTGAGATCCCTACCTTGTCAGAGCTGTTGCCACTTCCAGACACGCCGATGACAGAGGGT
ATCGCCTCGACTGCTCCGGAAGACCCCGTCCAGACAGCCCCAGTGCCTCCCGCCCCACTGCAGCACCAGTCATCGCCCTT
CGCCAGCGACAATCATGGCGACAGCGACACTGGCGGCTGCAGCACGACTCCGGCAGAGACCGCTGGTCTTCTGTCTCCCC
TGCCTTCTGCCCTAATTCCATCGACCAGTACGAAGGTCTTTGGAGGGCCGTCGTCATCACCAGCGCCAACCTCTTCCCCA
GCAGCCACGGTCCAGCTTGCACTTCCGACATTTCAGTCGCTGCCGCCCTCGGATCGTGCAATGCCCGTGGCTGACTTCCC
TCTTCCGGACGCTCCACCCGCCACCCTCGTCATCCCCTCTCTGCCCCCGCCGGTCGTTCCAACGGCAGCAACATGGCCAG
CGTCAGCTTTCGTGCCTGCGCCAGCTGCCACCGGCATTGACGAGAGGGAGATGATCGGAGTCGAGAGCTTGCTCGCGCTT
GCTCTCCCGGCCACACCCCCCCCTGTCCCCTCTCTACCGCCGCCGGTCATTCCAACAGCAGCTTCTTGGCCAGCGTCAGC
TTTCGTGCCTGCGCCAGCTGCTCCCGGCCATGACGAGAGGGAGATGGGCGGGATGGAAATGGAGTTTCCGGCTGTCCCAG
TTTCACTTCCAGTCCCAGTCCCAGCCCCTGCCCCTGCACCGACCCCTGCTGCTGTGTTGATGCCGCCTCCGCCTCGGCCC
AGACCTGCGCGGCCGCCAGTCCCCACAACCACCACCAGCCAGCCAGAGAGACCGTTGACGCCGATGCCGTCATCGTCTCG
GGTGGTCGGGACCCCGCCGGCGCAGGAACAGCCACAGCAGCAGCATGAGTCGCAGTCTGCCCGATCGAAGGGCAAGGAAA
AGGCAGCCGAGGACTGGGCGATGGACGCGATGGGAGACTCGGTACCAGAGTCTCCAGTTCGCACGACAGCGAGGGAGTCC
GGCCAGAGAAAGACTCTTGTGCCGCGACTGAGGAAGAGAACCGGAGGGAAACAAACGAGCGGGCCCTCCGCAGCGCCAAT
GCCCGCATTCGGTGGCGACACACAGGAAAGTCAGATGGCACCTGCATTTGACTTTACGGTTTCTGCGCCTGTTGTCGTCA
CCGCCAACACCGCCACCACCACAACCGCTTCGGACGTCGAGTCCGAAGCCGAATCCGAGGCCGGAACCACTGTCGGCAGC
AATGCTGACGCCGGCACCAACAACGACAACGACCGTGATGGCAACACAGGCAACGTCATGGTTATTTCCGGATTTGGCGG
CCAGGGTCTGGAGGGCTACCAGGCCCCATTGTTTGCGCCGATGCCAGAGGAGGTCGCGGCTGCGGTGGCTGCCACCGCCG
CGGCTGCTGGCCTGCCATCTTTGATCGGCGCAGACAGCGCCGCCAACACGGCAACGGACTGGAGTGGTGGTGGCCGCAAG
AGAGGGTCGCTCCGGGATCATGCCCGGGCGACAATGGAGGAATACCAGGCCATCTGGGCGGATGACAAAGTTCGCGGTTA
TGCCGTGAAGCTGGAGCAAGTCATCCGGGTGGGAGAACAGTTCCTCGGGATCGAGCAGATCGACGACGAGCTGGCGAAGT
CATGGCCGCACGCAGCGCGAAAAGAAATGCTGGTCTCTTTTGTCCAGCAACAGAGCACGCTTCCAGACAATTGGAATGCG
TCTCTGTCCACCGTGACGGAGCTCTCGTTGAACTGGCTCGACACGGTCAGCCACTGGGACGAGATCGAGGAATACTTCCA
GGAAAGCTTTGAGGCGAAGCTGTTCGAGGCCCTGGTGGGATACGACCTGCTGTACCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62