GenePrediction:GLEAN_4947 Details

Name: GLEAN_4947
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:441395..439834 (- strand)
Length: 1562
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:441395..441360 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_89:441274..439915 (- strand)
Length: 1360
Type: CDS
Source: GLEAN
Position: GCSC_89:439859..439834 (- strand)
Length: 26
>GLEAN_4947 class=GenePrediction position=GCSC_89:441395..439834 (- strand)
ATGAGTTTCCGCGGCTTCCAGAAGAGCGTGGTCCGAGTATGTAATCATGCCGACTTCCTTCTTTTCTCGCTTGCCCGTTT
GCTCGTCGTTCGTCGCTCGTCGCTCGCTAACTCCCACATAGGCACCACAACAATTCAAGGCCAAGTTCAACATTGGCGAG
CACACCAAGGACTCGATCTACCTGGACGCAGAACGGCGCTTTGACGAGGTCGAGAAGGAGACCAAGAAGCTGCACGACGA
GAGCAAGCACTATGCCGACGCCATCAACGGCATGCTCTCGCACCAGATCGAGTTCTCCCGCGCCATGACGGAGGTCTATA
AACCCATCAGCGGCAGCGTCTCCGATCCGGAGTCGTACATCTCCGAGTCCAATGAGGCCGGCATCCGGGCCTGTGAGGAG
TACGAGGCCGTGGTCAAGGACCTGCAGGAGACGCTCGCGCCCGAGCTAGAAATGATCGAGACCAGGGTGATCCGGCCGGC
CAACGAGCTGCTCGACGTCATCCGTGTCATCCGAAAGACTGCCGTCAAGCGCGAGCACAAAAAACTCGACTATGACCGCC
ACCGCCTCGCCCTCAAGAAGCTGCAGGACAAGAAGGAGAAGTCGCTCAAGGACGAGAAGGCCTTGTACAAGGCCGAGAGC
GACCTGGAACAGTCCGCCCAAGACTTCAACTACTTCAACGACCTGCTCAAGGATGAGCTGCCTAAACTCTTTCATCTCGA
GCGCCAATTCATCCAGCCGCTCTTCCAGTCTTTTTACTACATGCAGCTCAACGTCTTCTACACCCTGCACGAGAAGATGC
AGCAGTGCGACATTGGCTACTTTGACCTGACCCGCGACATCGAGGAGGCCTTTGAGAGCAAGCGCGGCGCCATTCAGGAC
GAGGCCGAGAAGCTGACCATTGTGCACTTCCGCAAGACCGGCGGCAAGCGCCCGCTCAACCAGTCCAAGTACGGCACGCG
ACCTGCCCTCGAGGCTGGCCCGCGTCCGCTCGCCATCACCGCCGGCCCGTCCAGCTCTTCCACCTACGACTACGACGCCG
ATAAGAACAGCAGCAACGGCAGCAAAGACGGCGCTGACGACCGCTCGCAGTACCACGGCTATGCCTCGGCCTCGTCCGCA
CGTCGGTCCGAGGACGTCGACCGTCCGCCTCCGCCCTACTCGGCCATCGGTAGCGGCGGCCTGCACAGCCCGTCCAAATT
TGGCGGTTTCGGCAACGCCACCAGCAGCAGCGGTAGCACTAACGCGCTGGCCGCAGCCGTGGCCGCCAAGTCCAAGCCGC
CACCACCGCCCAAGCCTAAGCCGACCCGGCTGAGCGCTGTGCCGGCTCCTGAGACCGTCACGGCCCTGTACGACTATGCG
GCTGCCCAGGAGGGTGACCTCGGCTTCCGGGCTGGCGACGTCATCGAGATTGTCACCCGCACGGGCAACGCAAACGAGTG
GTGGGAGGGCAAGCTGAACGGTCGGCAAGGACAGTTCCCAGGTAAGCAGATGCGTTGCAGTAAGACCAAAGACCAAAGGC
TAATCAACCTTTGCAGGAAACTATGTTCAACTGAACAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62