GenePrediction:GLEAN_4949 Details

Name: GLEAN_4949
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:429861..423590 (- strand)
Length: 6272
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:429861..429682 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_89:429586..428155 (- strand)
Length: 1432
Type: CDS
Source: GLEAN
Position: GCSC_89:427092..426689 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_89:426107..425835 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_89:425748..424531 (- strand)
Length: 1218
Type: CDS
Source: GLEAN
Position: GCSC_89:424477..423590 (- strand)
Length: 888
>GLEAN_4949 class=GenePrediction position=GCSC_89:429861..423590 (- strand)
ATGACGGACCTGTCCAACCTGCGGACGGCGTCAGCGTATATTAACAACCAGCTGCTGTCGCGCGGGCTGCTGCGAGATGG
TAGCACCATTGACTTTGCCGATCCGTCCGGCAACGGCGACGTGGCTGTCACGATGGGGCGGATCATCAGCGTGGTCAACG
ACCTGATTTTGCGGCGAGACGTATGTTTGTGTGCGATTGTGCGGTCGTGCAGTCGTGCGAGCGTGCAATCTCATGCTCAT
CCCCCTCAGCGTCCATACTAACGGTTTCTTCGCAGCGAGACGCTGAACATCGCGAGTCTCTCTCGGCGGCACTGCGAACA
GTCCGGGCGGAGTCGCTGCGCCAGACCAACGACCTGCAGCGAACGATGGAGCGGCTGGCCGATGCGGAGCGCCACGTCGA
TCTGGCCGACGCTGCCGAGATACAGCTGCGCGCCCAGCTGGCGGCGGCCGAAGCGGCTGGCCGACGACTACGCGACGATG
CCGCGCGCATGCGCACGCTCGTGGCGCAGACGCGGGCCTCATGTACGCACGAGGTGCGGAAGCGCGACAGGCAGATCGAC
GGCCTGAAAAAGGCCGTAGCTGAGGCTGGACGGGCGCGTGGCGAGCGGCGCAACCCGACCATCACATCGATCACCATTGG
GGGCGGACATCCATCAAGCCACAGCAGCGCTGCTTCCTCGCCGATGCCGTCGGCCGCCAGCGGTTCCGAGTCGGCCGGGA
CATCGGGGGGCGCGTACGACCTCCGGAGCGAGACGAACGCGTTTCTGGCCGAGCTGGCACGCGGCCTCAGTGACGACAAT
GAAACGCTGCTCGGGCTCGTGCAGCACACCAGCCGACAGCTGAAGGCGATGAGCTGCTACGACGACGACGAGGGACCGCA
GGCCAGAGACGCCGGCGCCGACGCCAGCCTCGATGCACTCGCCCAGGACATGGACGAGGTGCTTGAGCACCTGCGCATCA
TCCTGACGAATCCGGCGTTTGTGTCGATCGAGGAGGTGATGCAGCGCGAGTCCGAGATCGGCCGGCTGCGCGACGGCTGG
GAGAAGATGGAAGGCCGCTGGAAGGAGGCCGTGCATCTGATGGACGGCTGGCGACGCCGCATGGCCACAAACGGACGGTC
CGTCAACATGGAGGAGATCAAGATGGGACTGCGACTGAGTCCGGTGCGGGTCAAGAATGTGGCCGAGACCCGCAGTCTGG
GACTGGAGACGCTGGCCGAGGCGGATGAGATGGATGAGGATGAAGATGATGACGACGACGACGAGGATGACGACAACGAC
GACGACGAGACGGACGAAAAGAAGGGACTGCAGACAGAAGAGATGGAGTATATCTATGAGCGAGAGGAAGAGGATAGATT
GCTGCAACAACAACTGCAGCAGCAGCAGCAGCAACAGCAAGAACGGCAAGAACGGCAAGAACGGCAACAGAAACAGCTCC
ACAAACTACTGCTAGAGCAACAGCAAGGGCACAGAAGAACGCGCAGCAGCGAGGACGGGTCACTGCGATTGGTACCGGCT
CCAGAAGGCGAAGACGAGCCGCGGCTGTTTGAAGACCTGGACGTCGACAGCGAGGAGGACGAGGAGGAGGATGAGGAGGA
CGAAGACGACGACGACGACGACTTGGAGCTGGATGAGGAGCCCAACGTGCAGATCCTGGCACAGTCGCTGGTGATGCCGT
CACCAGTGCTGCACCACGTGACTTCGAGTGATACGCTGGCACGATACACACCATCGCCGTTACCACCGTTGGCGTCACCG
ATTCACGAAGCAGAAGAAGAAGTGGTGGTGCAGACGCCGGCAGTGAAGCAAGGACCGGTCACTCGGTCAGCCACACGATC
GGCCACACGATCGACTACGCGATCGGCCACGCGATCGGCCACGCGAGCGGCAGCCCCGTCGGCACACAGCACGCAGGCGC
CAGTGTCGCGGCCGACGACGAGAGCGCGGCCAGGTCTGCGGCCGTCGGAAACGGCGGCAAACCGAGGAGACGCCGGCGCC
AGCACCAGCACGGACTCACCTGCAGCCTCGGATGGGATGCGTGGCAAGAAACGGCCACTCGACGATGCGGCAGTGCTGAC
TCAGCCGTCCCGGACACAAAAGCCGGCAACGAGGGCAGGAGCAGGGGCAGGAGCGACGACAATCGCACCAGTCGCACCAG
TCGCACCTGCCAAGAGCATGGCAAGCCCCACCCGGCCAGCACCACTACGGCTGGGAGGACCAACTGCTGCAGCCAAGCGG
AGGCCAGCAACAGCACCAGCGACTGTTACATCCGTACCACCATCGCCGACACGCGCGACACGCACGACGACGGCGTCTCG
AGCACAGCAGCGGGCGGTGGGAGGAGGTGGAGGTGGAGGCGCAGGTGCGGGTGCAGGTGCAGGTGCAGGTGCAGGGCGAG
CAGCAACGACGAGAAGAGGACCAGGATTGACTGTCAAGGTGGACAGAACGGACAAAGCGAGCAAGCTGGAAAGGCTGCAC
TCGCCGACAACACCACGACGAGAGCACAAACTGCCGCCTCTGCCGACGACGGCGGCGACGACGACAACAGCCATGGCGAC
GACGGCAGCAACGGCCACGATGACAGGACGGAGACGCAGTCGATCATCGCCAGCGAAGCCAGAGGTGGGAGAGAGGGAGA
GGGGGGAAAGGGGGGAGAAGGCGGAGAAAGAGAGGGAGAAGGAAAAGGAAAAGGCAAAAGAAAAGGGAGAGAGGCCAGCA
GAGACGGCACCCGTTCCGTCATCTTCTCGTCTGCCACTTCCGGCCACAGGCATGCAACCAGTCAGTCCAGCGCTCAGCAT
GGCGGCCATTGCAGCAAAGCTGGCGGCATCGGAGCGCGAGGCAGATGCAGCGCGGGTGCGGGCGAAGCTGCGAGCCGTGC
GAGGAACGCGGTTGGGGGTCGATAGAGCGAAAGAGGTGGTGCGGACGCCGAGAGAAGAAGCCGTCCGGCAGACGGATCGG
TTGCCGGCCGACTCGGTCGATCCGGTCAAGCGCAGCCGGCCGGTCGACGTGGATGCCATGGACGTGGCCGAGCTTGGACT
GTCGGGGCAGTCGGCACGCTCAGGACCCGTCCAGCGGTCACTGCGATCGGCTCATGCGTCACCCTGCAGCTCGACGGCCG
AGCTGGCCGTGCCACGGAGGAAGCTGCATCGGGACCAGCGGCGGGCCAGCAAGGTGGCATCGCGGCGACGCAGCACGCTC
AACCAGTGGGAGCTGGCCAGCCTGATGGCAGGAAGTGCAGAGGAGTAGGAGTGGAGGGAGAGAGGAGAGAGAGGAGTGGA
GAGAAAGGGGAGAGAGGGGAGAGAGAGGAAAGAGGAGAAGAGAGGAGTGGAGAGAAAGGAGAGAGGAGAGAGGAGAGGAG
AAGAGAGGAGAGAGGAGAGCAACGAGGAGAGCAGATGCGACAAGGTCACCGGCCTTGACGACATTTCCTTTGTCTTTCCT
TTGTCTGGCCCGCCGGGCCTCTAATGTGTGCATGTCCAGACTCTCAGCCAGATAAAAGGCGAGGGCTAGGTTACGATAGT
TACGATCCATGTCTATACCAAGGGAGGATCGAAGGGTGTACAGTAGTAATGCACTGTGTATGGAGCCGTATGTCTTGGAT
GCACTGTGTTGTACTGTCCTGTCCCAAAGGGAAGCCGCGTTCGCGTAGTGGGTCCATGTATTAACGCGTCTTCAGCGTTT
CCTCGTCCTGCGTTTGCGTTCTGCTTTCTGCTTCTACTTTCTGCTTTCTACAATCGACATATACGACAGGCCAGACCGGG
ATGGAGCCGAGCAGAGGGCCAGCCAGTGCGGCGAGCATGCCCAGGAAGCGAAATGCAAAGGCGGCAGCAGACGGGGCGAC
GGACAGCGTGACCGCACAGGCTGGCCGCGACGCCAAGAAGGCGAGGACAGCTGATGACGAGGCTGCTGACTCGGGGCGAC
CGTCTTTTGGAGGTGCAGCTCGCAGCCGGATGGAAGCCTTCTGGGATGATGGCGTGCAGAAGCAAGCGGACGGTCAGCTG
GAGGCGGCCCTGGCAGCGCTTACCAAGGTGAGTTCAGGGTTCACGGGGGGGAAGCTTACGGAAGAGGATTCACGGCTCAC
TTTGAATAGGCCCTTATTCTCTGTTCGTGTCAGAACCAGACACGGCAGCAATTCAAGGCGGCAGGCGTGCCGCTCAACAC
GATCTGTCCGATCGGTCGATGCTCGTGCAAAAACTTTGTGGCGGCAGCACAGACACGACGGCAGCAGCAGCAGCAGCAAG
AGAGACGAGACCCATTTCCGATCAGTCAGCTGGACCTGGATGCGGTGTACCGGCTAGCAACGTCACGCGGCTGCAGCTGC
GGCTCTGGGCGGGTGCGCTGTGACGAGCGGTCGCACGTGGCAGTGGTAGACCGAATGGCGATGGTGGCAGCACGGCTGGG
TCGTCACGACGAGGCGCTCCGGCTGGCACAGAGCATCGTGGATCTGGCGCCACAGCGGGCTGAGGGCTATCTGCGGCTGG
CCAAGGCGGTGATGGGCAGCAGCAGCCACGACCGATTCGCGGCTCGCTGTCTCTACGCCCATGGCCTCCACAACGTGCAG
ACACACGGCAACGGCGACGACCCTCTCGTGCAGGTCTTGGCCCACTGCAGCGCGCGCTACGGCTCGGCCGACTACCTGCC
GCAGCTGCCGGTCGAGACGGTCGAGGCGGTGCTGTCCCATCTGACGCTGGCCGACGTGCTGCGGTGCTGCCGCGTCAACA
AGACGTGGGCATCGGTGCTGCGACAGGTGCGCGTCCGGCTAGACTACGTCGAGCTGGGACATCGCTTCGCCGTGCATCGA
GCCGGCCGCGGCTATCGGCCGGATGCGCCGGTCGGCCTCGGCTCCCTCGCCCGCCTCTTACGACGACTGCCGCATCTCGA
AGCGGTGGCCCTGAAGCTGAGCGCCCAAGGCTACCTCGAAAAGAACGGCCGGGTCGATGCCACCGGTGCCATGGCGCCAT
GGATCGCCGCGGCCCTGCACCATTTTGCCGGCGTCGAGAGCCTGACGATCTGGCTGCCCGAAACCTGTCCGCGCAGCTTC
GCCGACATGCTGCGCCAGAACGACAGCCCGCTCCCGCCGTCGCAGCGTGCCCATGTCTGCCTGCTCAGCCGCTGCCAAAC
GCTGAGCCTGAGCAACATCAATCGCTCCAATCGTGCCGCCGTGCTTGGACTGCTGACCGACGCCGGCCCGACGATGCAGT
CGCTCCAGTTCTGCTGTTTGAAGAAAGGGACCAGCATCAGTGTCGACAACGTCGACCTTGCCTTGCCGCACCTGAGGTCC
TTCTGGATCTGCAAAGGCTTGTGGACACTTCTCCCTGCTCTTGATATCGTGGTAAGGCAACCGGAAGCGGGGAGAACGAG
AGAAAGAAAAGCTGACAGGAGCAGCCCAGAATCTGCATGGCCGCGCCGGGCCTCCAACAAGTCTTCTTCGATGAGGTTTC
CTTCGACTTGACCGTGCACGAGGCCTTTCCGGGCTATGATGAGGCGGTGGTGCTGCAGAATTTGCACACGTTCGCGGTAC
GCAACAGCAACCTGGGCACCACTCTCGGGTTCCCGGGCCCGTTTCCACGGCTTCCGGCAGCCACGATGCGGTGCGTTGAA
CTGAACTGCGCGAACCGCGGCGGCGAAATATTGCAAGATATGGTGCTGGGAGCGCTCCTGGAAGGCCTTCCGGTGAGCGG
TGGGATGCCGCGACTGGAGGTGTTTCGCTGCGCAGAATCGCTGATGGATGAGTCGCTGGAGCTGCTGCTGCAGAGCACGA
GGGGCGGATCTCTATACTCGCTAGAGATCTGCGGCAAGGAACTGGAGGCGTCACTGCTGTACGACGAGTGCCTGGCCGTG
CCGCATCCGAAACAGCTGCGCTGCATCGGCCTCTGCAACCTTGACTGGGACCCGGACCCAGGACTGCCAGGTTATGTGGC
TGGCCGGTCTGTCATCGCCTGGCTGGCTCAGTTTCCCTGCCTCGAGGCGGTCCGACTGCATCTGGAACGGCCCGACGATG
GCCGTCTGTTGCTGGCGCTGGTCGAGACGATCCGGAAAGCGAGAGAGGCTGCCAAGACGGACGATGACAGCACGACCCAG
AGGAAGAGCCCGTGGGCCAAACTCGTCACTATCTACTACAAATGCGGCTCGTCTGTCACGCGAGACCGAGCCGAGAACCA
GGCCCGCAGCCTCGGCATCACCGTCGATTTCACGGACCGTGATTTTTTTACGACGCCCACAATCTTCCCATACCCGGACA
AGAAAGAAGTTTACGCGTGGTGGAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62