GenePrediction:GLEAN_494 Details

Name: GLEAN_494
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:160108..161425 (+ strand)
Length: 1318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:160108..160261 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_97:160349..160533 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_97:160589..161425 (+ strand)
Length: 837
>GLEAN_494 class=GenePrediction position=GCSC_97:160108..161425 (+ strand)
ATGGCCGAAGAGTCACCCCATGTGGTGAGGATTCCCCGCTCTGACGAGGAAGGGTCCTTTGTCCTCGTCCGCGTGTCGCC
AACCATCCCCAGCTCAGGGCCGTTTGATGTGAAATTGGCGGCGACCGAGGGCGTGGCTCCATATGTTTTAACGCGTAAGT
TTTGGCCGTCTTTGGGTGGGCCCCTGCCTTGTTTACTCTGGAACGGGTAGCAGGTATATTTGTTCTGACTCTCAACACCA
GTGCGGCACAGTCGAATCGACAAGTTGCGGGTGAAGACCGCGCCATGTACCGCCGCCGAGTGGGAGCAATCGCTCGCATC
TGTCCTGCTAGACCAGGGACCGTTCGCCAATGTGGATGCGACGGCCACGGTCGAGGAAGAGTCTACGCTGACAATAATGA
TCCGGAGACGGATCGAGAACATTACAGTACGCCGCTTGGATTCGCGCTCTCGTTTGTGTTTATGCTGACACTTGTCTCTA
GCAACGCCTCGGCACGTTGTCTCTGGCATACAACGGGGATGAGGACATTGAGCTGTATGAATGGTGCGGAGAGATAGTTC
GCAGCAGGGCTCAGGCCCAGCAGCTGCTGGCCGAGACCATAGCAGAGCGAGACAAGCTGGAAAAGTCGGTAGATGAGCTC
CGCCAGCAGCTCGAGGAGTTCCTAGCAGCCAAGGAGGAAGATGAGAATGCCCTTTTGGAAAAGTTCTGCATGCTGCTCAA
CGAGAAGAAGGTCAAGATCCGGGTGCAGCAGCGGCTGTTGTCGTCGTATGCCGGCGGCAAGGTGGAGGATGCTGCTTCCG
TGGACGAGAGGAAGGAGATTAAGCAGGAAGAGGAGTCTCCCCCGCCAGCGGCTCGATCCAGCCAGCGCACATCCCGGTCC
AAATCTGCTGCCACCACGGCAGCCCGCCCGGTGAGGCGAGGGACGAAGCGGCCAGCCGCGGCGTCGTCCGAGGAAGAATC
AGACGTGGATGACGGATTCGAGAGGTCTACATCCCGTGCTGAAGCCGCACCAAATCCGGTCGAGAAGGACGCAGACAGTG
AGGATGAGGACCGAACGACGGAGAACGACGACGACAACGGCTCTACGGACAGTGAGGCAGGCGATCCCATGGATGTGGAG
GTGAAGGAGGAGAGTCAAGGGGGTGGGGACAAGATAGCAGCGGGAGTGAAGCCACGACCCACAACAGCAGAGGCAGTCGT
AGCGGCAGAGGCGCCGCCACCACGCCGCAGCATTCCTCTTGGCCAGACACGAAAGGCACCGACGCCGGCACGGCCTCTCC
GCCAGGGTAGCAATACAGATTCAGATGATGAGCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62