GenePrediction:GLEAN_4950 Details

Name: GLEAN_4950
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:418563..417764 (- strand)
Length: 800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:418563..418375 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_89:418288..417764 (- strand)
Length: 525
>GLEAN_4950 class=GenePrediction position=GCSC_89:418563..417764 (- strand)
ATGGCAAGGAGCGAGCAGCTTGGCCCCCACAGGTGCAAGTGGCAAAGACCATTGTTCGTCGACGGCCTTCTGCAGGAGCA
GGATGACTGCAGGCACAGGGCTGATGCGGCAGCCAGGGGAGGCCGACCAGAGCATCTGACGGAGTGGGAAAGGCACAAAC
ATCGGCAACAGAGCAGTCGAGCATGCATTGTAAGATACCGTCTGACAGCATAGGGCTGCAATGGGCCACGAATCGGGAAG
GCGTGCCCTGTATTGTTTCCGAATTTAGCTGACAGGGGCTCGGGCTCAGGCCGCAGTCGCCAGAAGGAGAAAGCGCGAGG
CCTCTGCTGACGGTCGCCGGGCGCTTCGTCTCCCAATGGGAGGACGTGACGGCAGGAACGAGCGCCGTGTCTGGCCACTT
TCCGACAGTCTCTGTGGACCTGTGCTTCGGGGACAGGAGGACCCTGCTACGAGGATCCTCTCCATTGTCCGCCCTTAGCG
CCTGCACTACAGAAGACCCAAGACGCCGGGAGAGCATCGCTACCCTTTCAGACCGTTCGTTGCGGCCACGCCTCACCGAG
ACCACACACCACACGGCAGGCTTTAGGCATCCGTGCCAGGCATCAAGGTCTGCGACGACCTTCTATGACGCATTCGTCCA
TCTGCCGGTAGCCCGAAATCCCAGGCTGCCGTGCCAAAAACGAAGGCGGAAAAAAGGCGCGCCAGGCTTCTACGATTCGC
TGCTGCCGATGGGATTTCTTCGCATCCTTGGCTCGCCCTGGCAGAGAGCCCCGTCGGCCGATCGGTCGGCGGTGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62