GenePrediction:GLEAN_4954 Details

Name: GLEAN_4954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:386627..385868 (- strand)
Length: 760
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:386627..386568 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_89:386480..386351 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_89:386273..385995 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_89:385923..385868 (- strand)
Length: 56
>GLEAN_4954 class=GenePrediction position=GCSC_89:386627..385868 (- strand)
ATGTACGATTCTTTCGACAACATGTACCAAGCGACTATTGGAATCGATTTTCTGTCCAAGGCAAGCTATCTCAAGTTGGG
AGCAGGCGGCATTATGCCGCCGCCAGCACTGTAACATATACGAGCCGTCACGACTAACTGCCTCTAGACGATGTACCTCG
AAGACCGAACCGTTCGATTACAACTTTGGGATACAGCAGGCCAGGAGCGTTTCCGGAGCTTGATTCCATCCTACATCCGC
GACTCGAGCGTGGCTGTGGTTGTTTATGATATTTCTAGTGAGCGAGCCTCCTCTCGGCCGACTTGTGGCCCCATTATCTT
CCGCAGACCGCTAATTGGCATGACTTGTACCCAGATGCGAAATCTTTCCAAAACACACGGAAATGGATCGACGATGTTCG
TGCAGAGCGTGGAAACGATGTCATAATTGTTCTCGTTGGAAACAAGACAGATTTAAACGACAAACGTGAAGTAACGACCC
AACAGGGCGAAGAGGAGGCCAAGAGGAACAACCTGATGTTTGTGGAAACCAGTGCCAAGGTGGGCCACAACGTGAAGCCG
CTATTCAAAAGAATAGCACAGGCCCTTCCGGGAATGGAAGGGACGGACGCCGCCGCACAAGCGTCAAGCCAGAGTCAGTC
GACCCCTCTGTTGTGTTCATTTCCCCTGCTATGCTGCCATGGGAGTTCTGGCTAACGAAAGCAGTGATTGATGTCAAGAC
GACGCCCGCCCCGCCAAGCCAAGAAGGATGTGCTTGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62