GenePrediction:GLEAN_4955 Details

Name: GLEAN_4955
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:385304..384418 (- strand)
Length: 887
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:385304..384914 (- strand)
Length: 391
Type: CDS
Source: GLEAN
Position: GCSC_89:384857..384418 (- strand)
Length: 440
>GLEAN_4955 class=GenePrediction position=GCSC_89:385304..384418 (- strand)
ATGGCAGACGCAGCCTTGCTAATTGAACAGTCCAAAAAGGCTGCAGCATACCAGGCTGTCAAGGACCATCTCACACCTGC
TTTCCGGCATATCGGTATTGGCTCCGGATCCACGGTCATCTATGTGGTCGAAGCTATTGCCGCCCAGGGTGCTGACGTCA
CTGCACTTATGACGTTTTACCCCACGGGAGATCAATCGATGGCCCTCATCGAAGATGCTGGCCTGCGGCTTTCCAGCATT
GCTCAGCTGCCACTGAATACCAGCCTTGATGTCTGTTTTGACGGTGCCGACGAGGTCGACGAGGAGCTCAACCTGATCAA
GGGTGGCGGTGCGTGTCTCTTCCAAGAGAAGATCGTTGCCACATCTGCCAAGAAGTTTGTCTGCGTGGCCGGTACGTTAT
CCAGCCTGAGAAGATCCAGATGGGAGGGGGGTGGTCTAACAACGTAGACTACCGGAAGCTGGCGCCGCGTCTCGGCACCA
ACTGGAAACAGGGAATTCCAATTGAGGTGTTGCCGCTGGCAGCGAAGCGCGTCCTGAACGAGCTTGTGCAGCTGGGAGCA
CAAAATCCGCAGATCCGCCAAGGACTCCCGCGCAAGGCTGGTCCCGTAGTCACCGACAATAGTATGTGGCTGATAGACGC
ACCTTTTGCACCCCTGCAGCTATCCAAAGACGGCTTAGAAGCGCACGCGGACGGCGAAAATGGCATCTGGACGGTGGACG
GCCTGGCTGATCGGCTGATCAAGATCCCCGGCATCGTCGAGATGGGCCTGTTCACGGGCATGAACGGCTACCAAATCAAG
GCCGGCCATGGAGGTGCACAGAAGCCCGTCGCTGCGTATTTCGGCATGGCCGACGGAAGCGTGAAGATTCGCAAGGCGCA
TGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62