GenePrediction:GLEAN_4957 Details

Name: GLEAN_4957
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:381294..376349 (- strand)
Length: 4946
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:381294..381255 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_89:381033..380885 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_89:380796..376441 (- strand)
Length: 4356
Type: CDS
Source: GLEAN
Position: GCSC_89:376378..376349 (- strand)
Length: 30
>GLEAN_4957 class=GenePrediction position=GCSC_89:381294..376349 (- strand)
ATGGCTTCGTCTGCTCCGGTCAAGACTGCTGGCGAAGCAGGTACGTGCACGCTTCTTGCTTTCTTTACCGGTTGTTACTT
CTCTTGTTCGGGATGGTTCGTCCTGTCTCGCACCTGCCCTGTGCTGGTGGTGCAGCATGGACAGAAGGAATTGGATGGAC
ATTGGCATTTGTAATCCAGCTGCTTCCCAGACAGGAGCCAACACAACTTCTCGCAGAAAGGCTGTCAAACTATAAATATG
CTGACCAGAGTTGCTGCACAGTGGCGAGAATTGCCTACCTGGCCAGCGATGTTGTCATTTCGGTCCAGCCGTCGCTGAGC
GCGGATTCCGAGTTCTCGGAGCAACTGAAGAGCCTCGAGAAGAAAAAGGTGCCAAGCATCATTGCATCGACAGCTGATGC
TGTTCCTGAGGTTGGTGACTCCCTGCAGCTGGACTTTTTTTCTGCCGCGAATCGGAAGAGGGGTTGTATTGCAGCAGCTA
ACATTGGCTGCGCACTAGATCCAAACAGTGCGGTTTAACACGGACCCCCTGCTCTCAGTCTTCGGCCCCATCCGGTCAGG
TCGTCTGGTCTCGGTCACGACCAGCTCTGTGATCCTGCTCTCTTCAGTGTCGCACCTTTACAAACTCGCCAACTTCCCGG
TTGTTCTTCACGTGGCGCTCCACCCCGACCAGTTCCCAGACTACTCATCCATCACAGCAATTCGCAATGCTGGCTGGACC
TTCCTGCAGTCCGGCTCCGTTCAGGAAGCCCAGGACATCGGCCTGACAGCTCACGCTCTTGCTATCCGTTCAGGAAAGGG
CGTTGTGCATTTCTTCAGCGCTACCGTCCAGGCGGAGACTGCGCCGGTTGCCCCCGAGGACTCAGAGATTGTCCGGGAAA
TTCTGAACATCGATAACGCTCGTCGTTTCCAGGCGGCCCCTGTCTCCGGCACGGCCATTTATGCCGATGAAGGCCGCATA
GCCGTCGTATCAGACGCTCTCGAGACAGCAACTCCCGCTGCTCAGTCAGCGGTGGCAAGCAGCCTCCAGCTCCCTGTGGA
CCCGAGCACAGCGTCCACCAGGGCATCCGAACAGTCCAGCCTTTTGAGCACCACGAGCTCGCCGGCGCCGATCTCCCCAG
CGACGACGATCGAGCCCAGTGTGCCTGCCATCACCTCAGATGACATTTACAAGTATGTGTCGACTATCTGGAGCCAGCTG
GAGAGACTTGTCGGCCGCAAGTACAGCGCTTTTGAGTGGACCGGCCCTGCCAACGCCGAGAACTGCCTGTTCGTTTTTGG
CTCTGATCCTACGCTATTTTCGACAGCCGAGATCGCCGCATCGACCAACACCGGTGTCCTGACCCCACGGCTGTACCGGC
CGTGGCTGGGCTCCAAGCTCTTAAACGCCTTGCCCAAGACTGTGCGAAGGATTGCCGTCCTGGAGCAGATCAGCCGCAAG
ACAACGAAGTGGGGCCCGACGTTGCTGGACGTCTTGACTACGGTGAAGAGCGGCCCTGGCGGTGTTGAGACCATTGTCGG
CTACCAGGTCGGCTACCTCACGCGCGAGACTGTGGCCGAGGCCCTGCGCACCGTCCACGAAAACCTGACGGCGACCAAGC
CGGTGCAGAACCTGAAGATCGGTGCGCAGGAGATCCCAGAGGTTACCGAAGTGTCGTATACTCTAGAGCAGCCCAAGACC
GAAACGGCATACACCAAGATCCTCAACCAGCTCTTCAACGACCGGCTCTACGTGGCAAATGCGCTGGGCTCAGAGAATGC
TGGTATCTCCAGCACGGTTGCTGCGACTCCTGAGTTTGGCTTCGGTTCCCTCCTTGCGCGGAAGGAGCACCGGCAACGAT
TCGTGGCCGATGTAAAGCGGGCTGCCGTGTCGGATACGTTCCTGACCGCGGCGCCGAACCGCCTGCTTACTCGTTGGGCC
GCAGTGGCCAACGACTCCAAGAAGGCGGATGAGGTTGCCGACGAGGTTCTGGCGCAATTTAAGATCGACCGCTCAGCGGC
ATCCCGCAAGCTGCTGGAGAACAAGCACTTTTTCCACAACGAGTCGCTGTGGCTGGTAGGTTCGGATGCCTGGTCTTACG
ATCTGGGCAACTCTGGTGTGCACCACGTGCTGGCATCTGGTGAGAACGTTAATGTTCTCATCATCGACTCGACGCCGTAT
TCCGAACGTGTTGCGGCAGATGCGAGTCGGAGAAAGAAGGACATTGGGCTGTACGCAATGAACTTTGGCAACGCATACGT
TGCCTCCGTTGCCGTGTACAGCTCCTACACGCAGGTTCTGCAAGCCATGGATGAGGCCAGCAAGTTTAACGGACCGTCTG
TTGTGCTGGCGTACCTGCCGTACTTTGGCGAGCATGATTCGCCACTGACGATTCTGCGCGAGACCAAGTCTGCAGTGGAC
CTGGGCTACTGGCCTCTGTACCGGTGGAACCCGAAGAACGAGGAGAAGGGAGAGGCCAACTTCTCGTTGGACTCGGAGCG
CATCAAGAAGGAGCTCAAGCAGTTCTTGGACCGCGACAACAAGCTCACGCAGCTGATGCAGAAGGAGCCCACTTTTGCTG
CGACTCTTGCTCAGGACTTTGGAACTGAGGTTCGCGACCAGCAGAAGCGCAAGGCTCGGGATGCCTACAACGTGCTGCTC
GAGGGCCTGTTTGGTGCACCGCTTACCATCTTGTATGCGTCCGACAACGGCAACGCGACGACCTTGGCGAAGCGGCTTGG
CAACCGGGGCCGTTCGAGAGGCCTGAAGACCACCGTCATGGCGATGGAGGACTACCCGCTGGAAGATCTCTCAACGGAGG
AGAACATTATCTTCATTAGCTCCACCGCAGGCCAGGGCGAATTCCCGCAGAACGGTCGTGCTTTCTGGGATGCCATCAAG
GACAACAACGAGCTGGACTTGGCGGGTGTCAACTACTCCGTTATGGCTCTTGGCGACAGCCACTACTGGCCCCGGAAGGA
AGACAAGGTGTACTACAACAAGCCGGGCAAGGACCTGGATAAGCTGCTGGCTAACCTCGGGGCCAAGCGGCTGGCGGATA
TTGGTCTGGGCAACGACCAGGACCCGGATGGCTTTCAGACTGGGTACCAGGAATGGGAGCCGAAGATCTGGCAGGCTCTG
GGCGTGGACAAGGTCGAGGGCCTGCCGGAGGAGCCGGCACCACTGACGAACGAGGACATGAAAATACAGTCAAACTATCT
GCGTGGCACGATCGTCGAGGGCCTGAACGACACGACGACCGGAGCGATCAGCGCGTCGGACCAGCAGCTGACCAAGTTCC
ACGGCACATACATGCAGGATGACCGGGACCTCCGGGACGAGCGCAAGGCGCAGGGCCTGGAGCCGGCGTACTCGTTCATG
ATTCGGTGCCGGCTGGCTGGCGGAGTGTCGACGCCGAAGCAGTGGGTGCAGATGGACGACATCAGCAACGAGCTGGGCAA
CGAGACGATGAAGTTGACGACGCGGCAGACGTTCCAGTTCCACGGGGTGGTCAAGGGCAAGCTCAAACCGGCGATGCAGG
CGATCAACCGGGCGCTGATGACGACGCTGGCGGCGTGTGGTGACGTGAACCGCAACGTGATGTGCAGCTCGCTGCCGACG
CAATCGAGCTACCACCGCGAGGTGCTGGCGTGCTCGCAGCGCATCAGCGACCACCTGCTGCCGGCCACGACGGCGTACCA
CGAGATCTGGCTGACGGACGACGACGGCAAGAAGACGCAGGTGGCCGGTGACGCGGTGCAGGACTACGAGCCGCTGTACG
GGCCGACGTATCTGCCGCGCAAGTTCAAGATCACGATCGCGATTCCACCACACAACGACACGGACGTGTATGCGCACGAT
GTGGGCCTGGTCGCGATTGCAGGCGCGGACGGCAAGCTGGCTGGCTTCAACTTGCTCGCGGGCGGTGGCATGGGCAGCAC
GCACAACAACAAGAAGACATACCCGCAGACGGGCCGGATGTTTGGGTTCGTGCTGCCGGAGGACGTACAAATTGCGTGTG
AGAAGATCATGCTGGTGCAACGCGACTTTGGCGACCGCAAGAACCGCAAGCACGCGCGTCTCAAGTACACGATTGACGAC
CTCGGGGTGGACGTGTTCAAGGGCAAGGTGGAGGAGCTGTGGGGCAAGACGTTTGCAGCGCCGCGGCCGTTCCACTTCGA
TTCCAACGTGGACACGTTTGGGTGGCAGCGTGACGAGAGGGGCCTGAACCACTTTACGTGCTTTGTGGAGAACGGGCGGA
TCGAGGACACGCCGACGTTTCAGATGAAGACGGGGCTGCGCGAGATTGCAAAGGTGCTGAAGGGCGAGTTCCGGCTGACA
GGCAACCAACACGTGATGATCAGCAATGTGGCGGACGAGGACCTGGACGAGATCAAGGCGCTGATGAGCAAGTACAAGCT
GGACAACGTGCAGTTCTCGGCGCTACGGCTGAGTTCGTCGGCCTGCGTGGCTTTCCCGACCTGCGGACTGGCGATGGCCG
AATCGGAGCGGTACCTGCCGGTGCTGATCGGGAAGCTGGAGGACTGTCTGGAAGAGAACGGACTGCGGCAGGACTCGATT
GTGATGCGCATGACGGGCTGTCCCAACGGCTGCGCGCGGCCGTGGCTGGCCGAGGTGGCGTTTGTGGGCAAGGCCTACGG
AGCTTACAACATGTACCTCGGCGGCGGCTACCACGGACAGCGGCTCAACAAGCTGTACCGGTCAAGCATCAAGGAGGAGG
AGATTCTGGCGATCATGAAGCCGCTGCTGAAGCGGTATGCGCTGGAGCGGCAGGAGGGTGAGCGCTTCGGCGACTTCTGC
ATCCGCATCGGCATGATCAAGGCCACGCGAGATGGCCGGGACTTCCACGATGATGTAAGAATATACCGTCTGGAGTAACG
TATTTTACGTGACAGCAGAGCTAACCAACCGAACAGATTCCCGAGGACGAGTCGGACGAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62