GenePrediction:GLEAN_4959 Details

Name: GLEAN_4959
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:369767..369225 (- strand)
Length: 543
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:369767..369765 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_89:369710..369225 (- strand)
Length: 486
>GLEAN_4959 class=GenePrediction position=GCSC_89:369767..369225 (- strand)
ATGGTAGGCCAGCCGTTTCCGTGCGTCTGCCGCGGGCGCCCACGCTAATCTGTGCAGTCTCTCCGCATCGTCCCGGCCGA
CGTGCACACGGCCTCGTTCAGCCATATTGGCGCCCGGGAAAAGGGCGCCCCGTCGGCACCGGGCCTACACGACTTGCTCC
GGCGAGGCGTTGGTCCGACCAAGGCGACGACGAGCCCCGACGCCGCATCGACACCCGACTCGGCACATCCCCTCGAGGCG
CGGCTGAAGCAGTGGGAGGCCACGCGCGAGGCGCTGCGCATGGAAACGCTGCGGCGGGCCTTTGGCGTGGCCGAGCCGGT
GCGCCGCGGCATGGAGCTCAAGATCACGCGCGAGGGCGAGTGGCGGCCGCAGGTGCTGCGGTCGGCCGGTGGCGTCGGTA
TGGGCCAGCTGCCACGCAGCGTCCACGAGGACATCCTGATGGCCTGTGAGGCTACCGTCGAGTGGGAAGACGTCTTTGCC
GGCGACGAGACCCGGACCGTGCCCGGGATGCACGACGAGATGGAGCGGAAGCTGCGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62