GenePrediction:GLEAN_4962 Details

Name: GLEAN_4962
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:352139..350911 (- strand)
Length: 1229
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:352139..352014 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_89:351950..351288 (- strand)
Length: 663
Type: CDS
Source: GLEAN
Position: GCSC_89:351138..350911 (- strand)
Length: 228
>GLEAN_4962 class=GenePrediction position=GCSC_89:352139..350911 (- strand)
ATGTATGCGGCCGATCTGACGGCCGTCTTTGACGAGCTGTTGAAGAAGCATGGCGGCCGGCCGACGACCGGAGCGAAAGG
CGTCCCGGACACGACGAGTGGTTTTCTCAAGGAGGCCTACCGAATTGTGGGTTTCAGCGAGGGAGAGTAAAGGCGAGGAA
GACCAGGCTGACGATGTGCGCGCGCGCAGAACGGCCACATCGCGACGCTCTCGAAGCAGCTCGGCGACATCCGGCCGGCC
TACCTCTCGACAGCACGGCCGCGGCGCATCAAGCCGCGGCGCGGCGATGTGGGCGGCACGACGACCATGACCGGCCTGAC
CGACGGCCAGCGCGAGGAGATTGACGGCAACGCTAAGCGGCTGCTGCGCGACCTCAACGCGTCGATCCGCGGCCTGGCCG
ACGCCGAGGCCCTGCACCAGGAGACGCAGCGGGCGCTCGTGCGGCGCCGCCTGGGCGGCGGAGGGATGGGCATGCGGCTG
GCCGGGCTCGCGCTGCTGCCGTCGCACAGGTCAGCCGAGCAGGCCGCCGCCGAGGAGGCGCTCGGCCAGGTGGCAGCCCA
TCGTGAGAGCATCCTCTGGCTGCTACGACAGCGGCTGCAAGCGTGCGGCCAAGCACAGCAGACGATGATGGAGGCGCGGG
TGGCGCGCATGGTGGTGGAGACGACGGTGGCGGGATACGGGGTAGGAGGAGGTGGAGGAATGGCGACAGCAACAGCCTTG
GAACAGGACGAAAAGAGCCACGACAGCTCGCCCGCCCTCGACACAGAGGCCGGCCTGACGCAGGAGCAGCTGCAGATGTT
TGAGCACGACAACCTGGACATGCTCAAGTACTACGAGACCACGCTGGACAAAGTTCGGTGAGTTTTTTTTCTCCCGCTCC
TTTCCGGTTTTCCTCTTTTCTTTTTCTTTTTGTTCTCCTTTCCCCTCCCTTGTCCCCGTCCTGCTCTTCCTTCTTCCCAC
ACCGCCTACACCGCTCTAACACACACAGCGCGGCGGAGCAGTCACTGGTGGAGATCTCGGAGCTGCAGTCGATGCTCGTC
GGCAACCTGGAGCTACAGTCGGCACACGTGGACCAGATGGTGGCGGACTCGGTCAATACGGCACAGAACGTGGCGCGCGG
CAATCAGGAGCTCAAGAAGGCGCTAGACCGCCCGAGCGCGGCACGGTACACGTTCTACGCAGCCAGCGGCCTGTGCCTCT
TCGTGGTGGTGTGGGATTTCTTCGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62