GenePrediction:GLEAN_4963 Details

Name: GLEAN_4963
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:349463..347815 (- strand)
Length: 1649
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:349463..349332 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_89:349175..349116 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_89:348885..347815 (- strand)
Length: 1071
>GLEAN_4963 class=GenePrediction position=GCSC_89:349463..347815 (- strand)
ATGGCTGCCCAGACAAACGGCGTCAGCGCCACCAGCTTCCCGGCAGACGCTGTGCCCCAGGCACCTGAGGATCCGCTCTT
TGGGCTTATGCGTGAATACCGCGCCGACAAGAGCAAAGATAAGGTGGACCTGGTAAGACTTGCGCTTTTCGTCCTTCCTT
TGTGCTTATGCTTTGTGCCTTGTGTCTCGTGCTTTGTGTGTTTGCGCACATCGTGCGCCTCCTGATCTGGACTCACTGTG
TTCAGCCTACACAATCTATTTTTACACGACTTGCTAATTACTGTCCAGGGAATCGGTGCTTATCGCGACAACAACGGCAA
ACCATGGGTGCTGCCGGTGGTCAAAAAGGTGAGGTCGATTGCTAAAAATGGCACTCTCCATTGAGACTGAAGCTATTCGC
TATTGCTGGGTTTATCCCCCACGCGCCCAACCCCAGACCCCATACATTGCCCCATAGCCCATTGCCGAAATAACGCCGGT
GCACCCCGAATGCACCCCGTATTTTGCGAATCCTTATTCCCCGCCCTCACCTGTTCGATGGAGGACATGAGCTGATTTTT
ATTTTTGGTTTTCGCTAGGCCGATGAAATCATTCGCAATGATCCCGAAGCCAACCACGAATACCTGCCCATTGCTGGCCT
GGCCTCTTTTACTGGCAAGGCCGCCGAGCTGATCTTTGGCGCCTCATCGCCGGCCATTGTCGAGAAGCGCGTTGTGTCGG
TCCAGACGATCTCTGGCACCGGTGCCTGCCACCTTGGCGGGCTCTTCCTCGACCGCTTTTTCCATGGCAACCGCACCGTC
TACCTCTCCAACCCGACTTGGGCCAACCACAACCAGATTTTTGCCAATGTCGGCTTGCCTACCGCCCTGTATCCCTACTT
TGACAAGCAGTCGCGAGGTCTCGACTTTGCCGGCATGACCAGGGCCATTGAGGCTGCCCCGGACCACTCCATCATCCTCA
TGCACGCCTGTGCCCACAACCCAACCGGTGTTGATCCTACTGCCGAGCAGTGGCGCCAGATCGCCGACATTCTGCGTCGC
AAGCACCACCTGCCGTTCTTCGACTGCGCCTACCAGGGTTTCGCCTCGGGCGATCTCGCTCGCGATGCCGGCGCCATCCG
CTACTTTGTCGAGCAGGGCTTCGAGCTGCTGCTGGCCCAGTCATTTGCCAAGAACTTTGGTCTGTACGGCGAGCGGGCCG
GCTGCCTGCACTTTGTGTCGGCCCCGGGGGCCGCAGCTGCCGACACCACCAGCCGGGTTGCATCGCAGCTGGCAGTGCTG
CAGCGGTCTGAGATCTCCAACCCGCCCATCTACGGCGCACGTGTTGCCAGCACAGTGCTGAACGACCCTGCACTGTTTGC
CGAGTGGGAGGAGAACCTGCGGACGATGTCGGGGCGCATCATCGGCATGCGCACGGCGCTGCGGGAGAAGCTCGAAGAGC
TGGGCACGCCGGGAACGTGGAACCACATCACCGACCAGATCGGCATGTTCTCGTTTACGGGCCTGTCGGAAAAGCAGGTG
CTGAAGCTGCGTGAGGACTACCACATCTATATGACTAAGAACGGGAGGATCAGCATGGCCGGTCTGAACACGAACAACGT
CGAGTATTTTGCAAAGGCGGTCGACCAGATCGTACGGGCGACTCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62