GenePrediction:GLEAN_4965 Details

Name: GLEAN_4965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:331384..330763 (- strand)
Length: 622
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:331384..331369 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_89:331264..331070 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_89:330932..330763 (- strand)
Length: 170
>GLEAN_4965 class=GenePrediction position=GCSC_89:331384..330763 (- strand)
ATGCCTCTCCAGAACGGTAAGTAGCATGGAGCTATTGCGGAGGGAGCCTTGCGGGCTCCTCCGTATTAATCCGGCAATCG
TATCATAGTTGCTGTAGGCTAACGAGCACCAAAACAACAGAAAAGTATCCCTCCTCCGTGGCTTTCGACGCCATCAACGA
TGCCCTCGCCAACGACGACTTCAAGAAGGAGGCTATCAAGCAGGCCAAGGCTGTTTTCGGCATCACACTGAAAAACCCGG
CCGGTGAAACCGAGAGCTGGTTCATTGACCTGGCCAAGGAGGGCAAGGTTGTGCAGGGTCTAGACAAGTCTGATGGTACG
TTCTTACATTGACTTTTGCTCTAATTTTTCTCTTCTTTTGCCATACCTCATCAGTTCCCCTGCCCCGTCCGTTTGCAAAA
GCCCGCTTTTATTTGAATCGCTTTCTGCATGCGGATGACTAACCGTACCTAGTTGAGCTGCGGCTGTCCGACGAGGACTT
TGGCAAGCTTGTCCTGGGCAAGGCCAAGGCGCAATCCTTGTTTATGTCTGGCAAGCTCAAGATCAAGGGCAACGTGATGA
AGGCAGCCAAGCTTGAACCCATTCTTAACAAGGCGCAAGGCCAGACGAAGGCGAAATTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62