GenePrediction:GLEAN_4966 Details

Name: GLEAN_4966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:329778..328627 (- strand)
Length: 1152
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:329778..329438 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_89:329374..328627 (- strand)
Length: 748
>GLEAN_4966 class=GenePrediction position=GCSC_89:329778..328627 (- strand)
ATGGGCATTCTCTCAGACCTGAAGCTGCCGGTGGGCGTCATCTACGGCGATGATGTGCTTAAGCTGTTTCAGTATGCACA
GGTCCACGGCTTTGCCATCCCCGCCATCAATGTGACATCGTCGTCCACCGTTGTGGCTGCGCTCGAGGCTGCTCGCGACG
CAAAATCTCCCATCATCATGCAGTTCTCCAACGGCGGTGCTGCCTTCTTTGCCGGTAAGGGCATCACCAACAGCAAGGAG
AAGCAGGAAGCTTCGGTTGGTGGCGCCATTGCGGCTGCCCACTTCATCCGCTCCGTTGCCCCTCTTTACGAGATCCCAAT
CGTCCTTCACACCGACCACTGGTACGTATAAGCCCCCCTTCCTTCCAGCCAATTGTATTCGAGCGCGATTGCTGACCCGT
ACAGCGCCAAGAAGCTGCTCCCATGGCTCGACGGCATGTATGACGCGGACGAGGCCTTCTTCAAGGAGCACGGCCACCCT
CTGTTCAGCAGCCACATGATCGACCTGTCGGAGGAGCCGCTGAAGGAGAACGTTGAGATCACGGCCAGCTACTTCAAGCG
TGCCAAGCCCTGGAAGCAGTGGCTCGAGATGGAGGTTGGCCTGACTGGTGGTGAGGAGGACGGTGTCAACAACGAGAACG
TCGATAACGCTTCCCTGTACACCCAGCCGGAGGACATCTGGGAGATCCAGAAGACTCTGAGTGCCATCTCACCATACTTC
AGCATTGCTGCCGCCTTTGGCAACGTTCACGGTGTCTACCACCCGGGCAACGTGCGTCTGCACCCCGAGCTTCTGGGCAA
GCACCAGGCATATGTCTCGGAGAAGCTCCAGGACAAGTCCGGCAAGCCCGTCTTTTTCGTCTTCCACGGCGGCTCTGGCT
CGTCCAAGGCCGAGTTCGCCGAGGCCATCTCTCACGGTGTGGTCAAGGTCAACCTCGACACCGACATGCAGTGGGCGTAC
CTGTCTGGTCACCGTGACTTCATTGTCAAGAACATTGAATATCTTAAGACCCAGGTCGGCAACCCCGAGGGCGTTGACAA
GCCTAACAAGAAGAAGTACGACCCGCGCGTCTGGGTGCGTGAGGGCGAGAAGACGATGAAGGCCAGAGTCACTGAGGCCC
TGCAGGACTTTGGTGCTGCTGGTCAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62