GenePrediction:GLEAN_4967 Details

Name: GLEAN_4967
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:327741..322578 (- strand)
Length: 5164
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:327741..324141 (- strand)
Length: 3601
Type: CDS
Source: GLEAN
Position: GCSC_89:324058..323503 (- strand)
Length: 556
Type: CDS
Source: GLEAN
Position: GCSC_89:322743..322578 (- strand)
Length: 166
>GLEAN_4967 class=GenePrediction position=GCSC_89:327741..322578 (- strand)
ATGGAGACTCCTCAGAGACGGCAGAAGTCGTGGCTTAGCAGCCTCACTGGCCTCGTCAGTGGCAGCCGCTCTTCTGCGCA
AGATACCGCATCTGGCGTGGCTGCGGGCGTTATCACAGGCAAGAAGACAGAAAACGTTGATTCATTCTCCTACCGTCTTC
GCTCTGCTCAGGCAGGCCATACTACGCCCTCCCGCTACTCGGGCACCTTCTCCGCCCCCCCTGTCGAGTCCCCCGAGAGC
CCAGTCAAGCGCGCCTCACCAAGTCAGCTGGCACAGCGCAAGATGCATGAACGCGCCCAAGGTCCGTCTGGTAGGGCTGG
TGCTGCAGCAGCACACTCCAGCTCTGCCCGCGGCGAGAGCAACAAGAGCTACCACAGCGTCAGCTTCGATAGCCACCTAG
CCACTACGCCAAAGCGGACGAACTTCCCCTCTGCAACCACTCCGAAAAACGTATTTCGCGATTCCATGTCTCGCGACGTG
CCTGCGTTTACATTCACTCCCCGTGTTCCGGCCAACACCATGAGGGGCGGCTTCCCTGCAACAACACCGGGCCGGTCGTT
CCGCTCTTCGGGCATTGAGCTAAGCAGCCAGGAGATGGCCAAGACCTCATTCAGCGATTTGTTTGCAATGAAGATTCCCG
ACCCGGATCCGAAGTTGAGCGGCGAGGCCATTGCTGGCATGGTACCGAAAGATCTCAAGGCCGGAAGTCGGTCCGTCTAC
GCGAATGAATACTTGGCCCATCTTTGCCCCCCTGACTTCAGCGAGGAACAGCGCAACCAGTTCTTCTGCATTTTGGATCT
GCGGCGCCTGAAGTATGCTGCCGACGAAGTTTTTGTCAAAAAGGACTGGAAATTGAACATTTTGAACTTCGCAAAGGAGT
ACGAGAAGAACCGGAGCCTGATCATGCTGCGATACGGCCTTTACGAATTCAAGACGGTCAAGGTGTCGAAGGACGTCTTC
CAGAAATGGAAGGCGGACAACAACATCCCCGATCTGATGGAGGAAGATGAGCTTGAGGATACCATGACAAGCAAGTCGAC
AACTGTGCCAAAGGCCTCGAAGCTCAATGGCACTGAAGGCATTCTCCAATCCGGGAAACGCAAGGCCCAAGACGTAATCG
ATCCTGCTGCCATGGAGTCCTCCTCATCAACCTTTTCGGCGAACAAGCGATCGCGGCCTTCTGAAGGTTTCAAGGCCGAA
CGGGAGCCCCTGACGGAAACAAGCACCCCTCTCAACCAGTCCAAGCGGAAGGCAGCCCAGAACAACAACGCCGAGCAGAT
TCAGCGGTCAAAGATGCAGAAGGCAACGCCGAATCCGCCTTCTGCGGCCACGTCTGCCACCAGGGCGTTGTTTGAGAAGT
ATGCAAACTCTCCTTCCAAGGAGCCAGCTGCAACCGAGACTCCGTCTATTCTAGTTTCCAAGCCATTTGGCGAGAGTGGC
TCAAGCTTGAAGGCAGCCTTTAAGCCGAACACTACGGGACAGCTGCCCAAGTCATCCTCCGGCAGCCTGGCCCGTTCCGT
CCTGGAGAGTGGCCTGAAGACGAATGCAGGTCCAGCTGGTGGCAACATATTTGGCTATCTGTCAGACGCAAGCTCTGCAA
AGGGCAGCGGCAATGACAATGCCGATGCTGACGCGGAGGATTCCGACGAGTCAGACGGCCAAGAGGAACCCGAAGCACAA
GTGTCAAGCGACAGCACTGGCGCTTCTGCCAACGGCATCACCAATGCCACTGCAAAATCGGCGCCGTCGCTCTTCTCCGC
CGCCAAACCGGCAAGCTTGGTGCCTGGGGCCACAGGCGCTCTGGCCGGCTCGAGCGCTTCCTCGGACGTTTCTGAATCCG
CCGCGGGACGCAGTCTTTTTGATCGCGTCAACAAGACCAGTGATGGCCAGCCGATTCGTGTGTTTGGTGCTGAGAGCAAC
AGCTCACCCTTCGGCACGTCCGCATTTGGCGCTAAGGGCGCACCTGAGCGGCCGAGTCTCGAGAAGGAACCTGCTCTGTT
TGGCGGAAACAAAACATGGAGCGCCGATACGCCTATCAAGTTCGCCGGTGGTAACAGCTCTACGCCAGCGAAGTCCCTGT
TTGGTGCATCCACGACCAACAGCGGCCCGGCTTCTGCAGCCAGCACCACGCCGAATTTGTTCGCGTCGGCGTCCAAAGAA
AGCAAATCGGACGCTCCACCATCTCTGTTCGGCTCTGTTTCTGCACTGAAGGAGCCGAAATCAGCTGCTCCTACTTCCCT
CTTCGGGTCTGCTGCGGCGGCACCGAAGGACACCAAAGTTGACGCGCCTGTCTCTCTATTCGGTTCCAAGACGCCAGCGA
CATTGTTCGGCAATACCGCCAAAGATGCGCCGCAGTTCACGTCCACAACGCCTGCAGCAAGTACCGCGGATGCACAGCCC
ACTGAAGCGCCGCTTTTCGGCTTTTCGAACAAGCCAGCTGGCCCAAGCACGCCTGCTGCACCCTCGCTGTTTGGCGCCAG
CACTGCAGGGTCTGGAACGCCGGCTACTTCGCTTTTTGGTAAGGCACAAGAAAAGCCGGCCACGACGACGGCCACGTCTT
TGTTTGGTAACGCTGCGGGTACGTCGAAGACGGCATCTGGCTCTGTGCTGCAGTCGCATACTCTGTTTGGCGGTGCTCCC
AAACCGGAACTTGAGCCGCAAGGACTGAAGCGCACTGCGGACGACAAGGGAAGTTCGTCAGCGGCTGCAACGTCGGGGGC
TTCCCTCTTTGGTGGCGCTCTCCAGAACGGCACCTCCAGCAAGGACGAGCCTCAGGCAAAGCGGCCTCTATTCGGCAGCA
CTACGCCGTCTTCGCAAGCTCCGTCTTCCGCCCCGCTCTTCTCTTTTGGCAGCACAAGCACGAATGGAGTGAGCGGTGGG
TCCAAGGTTCCAGGAGAGACGGCCAAGTCGCTGTTTGGGTCAACTATCAACGGCAGTGCGGCAGAGCCGGCAAAGACACA
GGCTACTAGCCTGTTTGGGAGCACGACAACGGCGGCCGCCAATCCTGTCAGTGGCTCGATTTTCAACTTTGGCAACACCA
ACAGCAGCGCAGCTCCACCAGTCCCGTCGTCCTTCTCTATTGGAGCGTCGACGGCTGCACAAGACAGCGCACCACCGGCG
CCCATATTTGGTGGTGGCAATACTGTGTCGGCTCCCTCATCTTTCACGTTCAGCGTTGGAGGTGACACCAGCAACCAAGG
ATTCCACAATCCGTTTTCCTTTGGCGGTGCTGGGGCCGAAGCTGCTCCGTCTCTGAGCTTTGGGGGCGTTGCATCGGCCA
CGGTAAGCTCGTCTGCGTTCCAGTTCGGGGCTACCACGACGCCTGCGGTAGCACCTCCGGCCTCTGGCGGGATGTCGTTT
TCGTTTGGTGCCGGGGCACAGCCGTCGAGCCAGCCAGTCAACGCAGCACCTGGGAACTTGTTCGGAGCCACGCCGGCAGC
ATCTGGTGGTGCCAACGGCAGTTCAATGTTCAGCTTCGGTGGTGGTGCTCAGGCACAGCCCAGCAACACGCCCATCTTCG
GACAGCAGCAGCAGCAGCCGGCCCTCGGCGGTTCCATGTTCAATCTCGCCCCTCCAGTTGGCGGGACATCTACAGGTACT
AGTGAGTTATTCAAGAATTCCCCTGTTGCGGCTGGGATGTGGTGGCGCATGTAGAGTCGCTAACAAGCGTGCGCTTCTTG
CAGATACCCCCTTCACCAATCTCGGTGGCGCTTCTAGCCTGGCCACTACACCGGCCACGGGCACTCCCGAGCCTGGTGCC
GCCCAAGACAATTCGGACCATAATGGACACCAGGCTGACGGAGATGAGGCCCCACAGGAACAAATCAATTTAACCGAAGG
CGGACCGGGCGAGGAGGACGAGGCCGTCGCCTATGAAGTTCGTGCCAAAGCGCTCAGGTTGGCTTCGGCTAAGGAAACAG
ACGGCGGCTCGCCGGCCGCAAAGGACAAGAAGAACCCGTGGAAGACGGAGGGCGTCGGTTCCCTCCGGGTGCTGAAGCAC
AAGACGACGGGTGCGGTGCGGCTGCTGCTGCGAGCAGAGCCTCGCGGCAACGTTGCGCTCAACCGGGTTCTTCTGGCGGA
CTTCAACTACAAGCCGGAGCCCAATGCCAAGTACGTCAAGCTGACGACGTCCAACGAGGCAGGCACTGGGCTGGAGACTT
GGATGTTGCAGGTCAAGACCAAGGAAGCTGCTCAGAAGCTTGCCGAGGCTCTCGAAGAACACAAGTTGGCAAACAAGAAG
TAGGAACAGGTATGAACGGTTGAATGCAGCTCAGCGATCTCAATCTACTATTACCCCCCCTTCCCATATCCCCCCACCCT
CTACAGAACGTGTTTAATCTTCTCCTGCGTTGGTGCATATTTATGGCATATCCCCTTCTCCCACATCCCCCAGCCCTTTT
TGCATTGTACAACCCCCGATTTAACTTCAACCCCCTCAGACATGATGTCTTTTGCTTTAATTTCCAAGTAGGTTTTAATG
CCTTCTCGTCAAATCGTTTTAAGCGTTTCCCGTCCTTGTTTTGATGCCGTCTCTGCCACATCACATCCCCCCCCCGGAGT
TTTGGAGATGAAGTGAGCATAATTTTGGTTTCCTTTGCAAAATAAGGCATATATGTATAAGAACAGCGGAATGGAGCATG
TATGGTGTTTATAAAGAAGGAGATAAAAGGAGGTGAATAGGAGATGAATAGGAGGTGGATAAGAGGCGAATAGGAGTGAA
ATTATGCAACCGATTTGAACGTTGCAATAGTGCGGTTGATAAACTAATGCGTGAAGATAAGAGGCGGCAACAAAACGGGA
TTTACTGTCTCCGCTTTCCTGCTTACTCGGCTCAGCTCCGTGTGCTGTGTGATATTTAAATATGCCTGCGTCCGATAACC
AGACGTGATTGTGACTAGAGACAACCTTTCATCTTTTTCTTAGGAGAGTGATGCACAGCAAGAACGACAGAAGCAGAAGA
CGAAACGAATATTGATACACGATGCCGTGGACCGAAAGTGTGGCTCTTCAGGAGGTGCAACGTTCCAACAGCACGGTGCA
GCGAGAGATGGACAGCGAGGCGGTGCCTCTGGAGGCGAATTCGGCGACCGTGCGAGGGGCCAAGCTGTCGATGCGTGACG
CAAGGGTGCTGGCGGGCCAGGCGCTGCTGCAGCTGCCGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62