GenePrediction:GLEAN_4968 Details

Name: GLEAN_4968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:322520..317537 (- strand)
Length: 4984
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:322520..321498 (- strand)
Length: 1023
Type: CDS
Source: GLEAN
Position: GCSC_89:321069..320963 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_89:320903..320517 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_89:320452..320124 (- strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_89:320069..319091 (- strand)
Length: 979
Type: CDS
Source: GLEAN
Position: GCSC_89:318260..317537 (- strand)
Length: 724
>GLEAN_4968 class=GenePrediction position=GCSC_89:322520..317537 (- strand)
ATGGGCTTCGGCGTGTTCCAGGAGCACTTTTCGGAGCACTGGACGCTGGCAGGCAGCCAGAGCGCGACGGGCGTGATTGG
CACGACGTCCAACGAGGTCATGTACTTGGCGATGCCATTTCTGTTTGCTGGCCTGTCGTGCAAAAACGTTGTCGGCTCGA
CCTGTCCGTTTCTGTTCCGCCTGCTGCTGGACCGTCTGGGCTTCCGTGTGGCCCTGCGTGTCTGGGCGGCCGTGACGGCC
GTTTCGGGCGTGGTCGCCATCCTGCTGGTGTCGGGCGGTGGAGGCAGCAGTGGTCTGCCAGCTCCAGATCATCGCAGCCG
TTCGGTCCCGTGGAACTTTCTCCGGCACAGCACCTTTTATGTCTACGCAGTCGCCACGGTGCTGCAGAGCTCCGGCTACG
GCATCCCGCAGACGTACCTCAACACGTACGCCCACGACGTGACCCAGCTGTCGGGCGGGTCGGCCACGCTACTGCTAACG
CTCTTCAACATCCCCAGCATCGCATCGTCGGCCTTTTTCGGCTTCCTTAGCGACGACCGTGTCCGACAGACGCGGTTCCA
CCCACTGCTGCGTCTGCATCTGCTCTCGACGCCCGCCGTCACCGGCCTCTCGGCCGTCAGCTCTGCCCTGGCCGCCTGGC
TGCTCTGGGGTCTGGCCGCCCGCGGTGACATGGCCCTGCTCGTGCTGTTCGCGCTCGTCTTTGGCTTCTTTGCCGGCGGC
TATAGCGCCACCTGGGCTGGCGTCATGTCCGACCTCGAGCGCGAGGCGGCCCTGCGCAACGAGCCGGTCGACAGCGGATT
CGTGTACGGGCTGCTGAACGGCGCCCGCGGCATCGGCTACATCAGCGGTGGCTTCATCAGCGTCAGCCTGCTCCAGTCTG
GCACGGCGGCAGTGACAGCGGCCACAGGCTCGACAGTCGGCGCACATGCCGGCTACAGCACCAGTTACGGGCCGCTAATC
ATCTTCACCGGCCTGTCGACCGTTTTTGGCGGCTGCGGGCTGCTCTGGAAGGCTGGACGGGCAGTGCGTCTGCTCCTGTG
AGAGTGGGTAGAATGGGAGGCTGAAATGGGTGGAATCCGAGTCCCAAAAGTAAGGGCTCACCGCTTTTGGCAAAATAAGT
AGGTGAATAGTACGTTTATTTGTTAACACTGTATTTACCACCAATTTATTAGCGCAGTCTTATGTGCTGGGAGCCCTGTA
GCTATATTAATAAGCGGATCAAATTAGTGAGGTAGTCTACTAGGCTTTAGCGAGCTGTCGCTAATGGTTTTCTCCGTATA
TTGCTACTATGGAAAAGCGGTGAGCCCTTTCTTCTGGGAGGGACCTCCGTATCCGTAACTCAAAGACGGTGAGCCCGGTT
TTATCGAGCCGTGCGCCACACGGCCTGCAAACCCCGCCTAATTCTGTCGTGGGGGGTGTTTGCGAATTTTGGCTGTGACC
CAAACTATCAGAACGGACGAGCGTATCCGACCCGCGGTCTTCATAGAGCACGCAGCAAGCCGAAGATGCCTACGATTGCC
GTGGACAAGTACCGGCTCTTCGAAGAGCTCGGCCAGACGTCAGTGTCTCCGTGTCTGCAATTGCGCTTCGCATATGTCTC
TAACGGCCGTTGTGCAGCTTCACGCCCGATGCCTTCCAGGACCTCGCCTTTGAGTTTGGCGTGGAGGTGGACGAGGACAC
GGAGGATGATCCGTCACGGCCCAAGGATGAGCCGCCGGAGCTAAAGATTGAGATCGGTGCGAACCGCTACGACATGCTCT
GCTTTGAGGGCATCGCCATGAACCTCAACGTGTTCCGCGGCAAGATTCCCATGCCACAGTTCCAGCTGCTCGACATCCCG
GTCGAGAAGCTGCAGACGATCACGGTCAGCAAGGAGACGGCACGCGTGCGGCCGTTTGTGGCTGGCGCCATCCTGCGCGA
TGTCACCTTTGACAAGGCCGTGTACGACTCGTTCATCAGCCTGCAGGATAAGCTACACCAGAACCTGGCGCGCCAGAGAA
CGCTGTACGTTTGTGGTTTAGTGTTTTAATCTTATGGTTCTCGCTGACTCGCTCTCGACGACCGGCAGCGTCTCGATCGG
CACCCACGACCTCGACACGATCCAGGGCCCCTTTACGTACGAGGCGCAGGCGCCCAAGGACATCAACTTCGTCCCGCTCA
ACCAGACCAAGACGTTTGCCGGCGACGAGCTTATGTCCTTCTACGAGACCGACCGGCAGCTGGGCCGCTACCTGCACATC
ATCCGCGACAAGGACGTGTACCCGGTGATCTACGATGCTAACCGGGTCGTGTGTTCGCTGCCACCCATCATCAACAGCGA
GCACTCCAAGATCACGCTGAAGACGAAGAACGTCTTTATCGAGATCACGGCGACGGACGAGACGAAGCTGGACATTGGTA
GGTGGGGTGAATGGGGCGATGTTTCTGTCATGGCCTTATGCTAACCTGCAGTCTGCAACATGATGGTCACCATGTTCTCG
CGCTACTGCGCCAAGCCGTTCACGGTCGAGCCTGTGCGGATCGTGTCGGAGCACAATGGGACCAGCCGGATCACGCCGAG
CCTGACGACGCGGGTGGTGGACGTGGAGGTGCGTCACATCAACGAGGTGTGCGGACTGAACGAATCGCCCGAGGCGCTGG
GCCGGCTGCTGAAGAAGGTGACGTTTTCGTCGGTCCCGTCAGCCGACGGAACGGTGCTGCACGTGTCGGTACCGCCAACA
CGCGCCGACATTCTGCACCCGTGTGACATTGTGGAGGACGTGGCGGTGGCGTACGGCTTCAACAACCTGCCGCGGTCGTC
GCCGAACAAGGCGGCCACGATCGGACGGCCGCTGCCGATCAACAAGCTGGCCGACATTGTGCGGCTGGAGGCGGCCATGG
CCGGCTGGATCGAGGTGATGCCGCTGATCCTGTGCTCGCACGACGAGAACTTTGCCTGGCTGAACCGGCGCGACGACGGC
CAGACGGCCGTCCGGCTGGCCAACCCCAAGACGGCCGAGTACCAGGTCGTGCGCACGTCCCTGCTGCCGGGCCTGCTCAA
GACTATCCGCGAGAATAAGAGCGTGCCGCTGCCGATCATGATCAACGAGGTGTCCGACGTGACCATCAAGGACGAGTCTG
TCGAGCGCAAGGCCCGCAACGAGCGCCACTGGGCTGCCGCCTACTCGTCCCGCTCGGCCGGCTTTGAGCAGGTTCACGGC
CTGCTCGACCGCGTCATGCTGATGCTCCGCTGCGCCTTTTTGACGCGCGAGGAGGGCCTCACCTCCGGCAGCGGTGCCGG
CCTCGACGGCTACTTCATCCGCGAGATCGATGACCCGACCTTCTTTCCCGGCCGCGCCGCCGCCATCTACGTCCGCATCG
GCGGCGAGAGCAAGCGGATAGGCGAGCTGGGCGTGCTGCACCCGACCGTGCTGGAGGCATATGACCTACGGTGAGTTTTC
TGTCGTTTTCTGTTGTTTCTGTTTACCTACCCTCACCACTTGCTGACTGCCCAGGTACCCCGTAAGCACACTCGAGCTGG
ATCTGCAGGTGCTGTTATAAAATAGATGCACCCATCGATAGAGGAGAATAAAACAGCTCAAGACACCATGACGTGAACAA
GAGGATGAATAAGCAAGCCTACGTCGTACTTCGTCTGCGTAATAAGAGAGGACCCTTCCCAATGCAGATTAGCGGCACCC
AATGGCCTAGCAATTCTGGCAGCTACGACGCTTCTAGGCCCATTTGTGCTATTGATGACCGGGAGGCCCGGAAAAAGAGC
TGCAAGACGCAATGAAACAAGTCTAGGAAGGGATCCGCAAGCATTACCCATAAGGGGGGAACCCCATACGACTTCTCCTT
ACTCACTGTGGAGCTGCTGCTATAGTAGCAACGGGCGCCGGTTTTTGAAAACGTCCTGCAGCCCCGACCAACGACAGTTC
TGCATATCGACGTTGCTCTTGAGACAAAGCCGACTTCTTCGTGGCCCTCTCCACCTCCACGCACCCAAGACATTCCCGCC
GACCCCTGTCTCTGCTCTCCCGCTGCGTTCCGTCTCGCGCGCGCACTCTCCCACCGCTCTGTCGGCGTTCTTTTGCATCC
CGACAGCCAAGCTCACGGCCAGGCCACCTCTGTGCGCCTCTCCACGGCCAGGACACGAACTCGATCTAGCTTGCCCGTTT
TGCATCTCACCCTGACTTGTCTGCTCTGCGCGAGCATGCCTCACATTTGTCCCCGCATCCGCCGTCGATAGCTCTTCGAG
ACAGCTCCAGAATCCCCCAGGCCCACTGCTCACGTCCTGCTCGTCCGCCATCCCCCCACCGAGACCATGTCCGACAGCGA
CGGGGACGATGTCAGCTCCAACTTCTCCCATCTGCACGTGGCCGGCCTCGTCGTGCCCGTGCTCATCGTCCTCGGCGCGT
GCACCATGGCGCTCGTCGTCATCCGGCGCAACCGTCGGACACGCCAGGGTCTGTCGCTCAACCAGCAGGGCCGCCTCGCT
CTTGCGCGTGATGTGTTGGAGGACGGCCACAACGGCACTGCTGGCACCGATGCCGCGCAGCCAGGCCAACAGCAGCAGCT
GCCATCCTACACAAACGGCAGTCGCATACAGTCGCCGCCGACGGCCAACCGCTGGGCCTGGACAAACGCTGCCGGCATAG
CAGCGATGAGCGGTGGTGGCAGCCGTGTCCGACGCCGTGAAGACGGCCTGAACGAGCTCGGCGAGGCACCGCCGCCCTAT
GAGATGGCTGCCATGCACACAAAGGCCGCCGAAGATCAGGTCGCCCAGCAGCCGACGCCGTCGCCATCGCTGCTAGCCGT
GCCCGCACCCACACATGTCCGAGCCGCCACTGCACCATACTCCGTTGCGCCGTCATCGGCAGCACAACCACAACCACAAC
CTGCTGATGCTTCCTCTTCGCCCGCTGTCCCGCCCAGTCTGCCCCCGTCCTACAGTCCAAGCGTCCCAGCACCGGCAGCG
AGACCGTCTGCGGCCGACAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62