GenePrediction:GLEAN_4970 Details

Name: GLEAN_4970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:311249..310761 (- strand)
Length: 489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:311249..311210 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_89:311029..310761 (- strand)
Length: 269
>GLEAN_4970 class=GenePrediction position=GCSC_89:311249..310761 (- strand)
ATGGCCGATTTCGAGTCTAGCCAAGGCGCCTTTACGGCCCGTGCATTAGCAACAGGGATTGCTTCGACAACGTCTGTGGG
GCCAACAAGCCAGTCTTTCTGTCATTTTCTGTCATGCTGCCACGTATTCTGCTCGGCCTGCACTAATGGTGGCGGCCGGT
GAGGCTGGCAAAGCTCCAGCCTCCCTAACCTTGGTGGCGCACGCATCAATCCCACAGCAGTTCCGGTGACGGCAGCAGCA
GTGGCGCGCAGCCACACAGAACCAAGTAAATACCTGACAAACATCTGCATACGGTGTCGCTCGTACCCGAGCAGGCTGTG
GGAAGAGTACAGGGTGAAAGAAGAACTTGGCTGTCAGGACTGTCTGCCGTTCCACGTCTCGGTTGAGAAGCCTACGTCAG
CCACCTCGGAAAACTCGCCATACGCGAGGCGACAGGTGCGGAAGTGTCTCGCAATCGCTGATGAGGCCGTGTCTGCTACG
AACGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62