GenePrediction:GLEAN_4971 Details

Name: GLEAN_4971
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:307423..306998 (- strand)
Length: 426
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:307423..307223 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_89:307153..306998 (- strand)
Length: 156
>GLEAN_4971 class=GenePrediction position=GCSC_89:307423..306998 (- strand)
ATGCTTGTATCCACCCCATCCACCATGACTCTCGTCCATACAGTGCTCTTCCAGTTCAAGGAAGACAGCCAGCCAGAAGC
TGTGAAAAAAGCATGCGAGCACTTTCTGTCTCTCAAAGATTCGTGCATTTACCCGACTACCAACAAGCCCTATATCCTGT
CGCTCAAGGGTGGCAAGGATAATTCTCCCGAGGGCATGCAGGTACGTTCTCCCCCATAACAGAATTCCCATTATGTGCAC
ACATAGACACCTAGAAGCTAACCAGAGCAGAATGGTCTCACTCATGGATTTGTCGCGACATTTGCGTCGGCCGAGGACAG
AGACTACTACGTCAGCAAAGACCCGGTGCATCTAGCTTTTTCCAAGAGCGTTGGCGACATCCTGGCAAAGGTCACTGTTG
TCGACTTTCTCGACGGCATCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62