GenePrediction:GLEAN_4972 Details

Name: GLEAN_4972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:304923..301749 (- strand)
Length: 3175
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:304923..304549 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_89:304456..303156 (- strand)
Length: 1301
Type: CDS
Source: GLEAN
Position: GCSC_89:303089..302748 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_89:302679..301749 (- strand)
Length: 931
>GLEAN_4972 class=GenePrediction position=GCSC_89:304923..301749 (- strand)
ATGTCTATCTCCTCCGTTCATCCCAATTCCAAAGGGCACCCCAAAACGGACGACATCGCTCCGTCCAGCCCTACGACCAG
CATTTGGCTGGCCGCCATTGAAAGATACTACGACGAGCTCGCCAAGGGCGGAATCAAAGCCGCTGTCATTGACAGAGACC
TCTGGCGCATCAGGAGCCCCGAAGAACTGCTAGCCCAGATCGAAGCATTCAGTCCCAGTCAGAGCGACCAATCCAGAGCA
TGGACGAAGAACCTATCGCAGCTTCGGCCCATCCTGCTTGGACTCAATGACTTTGCTGCTCTCGCAGCGTGGGCGTTGGG
CATGGAAGGCAAGGTGGCGGCCGTTCTGTGGGGTTCCATTCGGCTCATTATCAAGGTAAGTTGCTGTTTTACGGGATATT
TTCCATCTTTCTCTTTGGCTTTTCCTCTTTGCTTTGTCACCGGGCTGACTCCTTCGGCGATGCTCAGTTTGCGCAACCCA
TTTTGCCCGACATTGTAAAAATGCTCGAGACCCTGCACCATGCCTTGCCACGCATGCAAATGTACGAAAATGAGCTGCCC
ATGACTGAGCCGCTCGAAAAGGCCCTCCTCGACATGTACAGCGAAGTGATTGTGTTCTGCGCCCACGCCATTGCCTTTTT
CCGCAACAATCCGAACGTAGGCCCGAATCGCCATGCCTGGTCTCAATTCAGCAGAGATTTTGCAATGGTCGTGGAGAACA
TCCAGAAGCTGTCTCGCCGAGTGGACGAGACGGCAGACATGATCCGGCTCTCTAGAGAAGCACGCACGGTGGAAACGGTG
GCCGCCTTTAAGAATTTGCAGCTTAAGGGCAACAAGGGTCCTCCTGCCAAGTTTCCCTGTTTTTCGGTACCGTACGGACT
CCACCTTCATTTATTCGCCAGGGAGATGGAACTGCAGACCCTCCAAGAATGCCTGGACCCGTCCTCGTCGTCCAGGACAC
AGCTCCAGGCCGTCGGCATCCATGGACTCGGCGGTGTCGGCAAGTCGCAGCTGGCTCTCCAGTACGCCAACACGTCGATG
CAAGTATATGACTTGATTGCTTGGATTGCCTCCGAGTCCCAGATCAAGCTCATCCAGAGCTTGTCCGACCTCGCTCGTAA
GCTGGGACTGGCCGGCGAAGCGAATCAAGACGACTACATAAGCATTGAGGTGGTCCGAGACTGGCTCAACACGTCGGGAA
AAACGTTTCTTCTCATCTTTGACAATGTCGACGACATCAAGCTGCTGCGCCATATTTGGCCTTCAAGCAACAAGGGTTCC
ATCATCATCACAACCCGATCACCGGTGTTGGCGGCAAAATGGGCCACCAAGACCATGCCGCTGGGCTGCTTCCCCGCTGA
TACTAGCCCGTCCATTTTGGTAGCCATGTCCGGTACGATTTGCTCCTCGCCTGAGGAAGATGCTGCATCGGCAGAAATTT
GCAAGCGGCTAGGCGGCTTGCCTCTGGCCGTGTCGCAAGTCGCCGACTTCATCCGCGAGAGAGGCTGCACGTATGCCGAG
TTTTTAAAGATATACGATAAGTCGGCCCACAAAGTGCTCGCCAAGGCGGACAACCTGGTCGGCTACGACCACACGGTGCT
GACTACATGGGAAATCTCACTGGAGAAACTGTCTGCCGAAGCGGCCCGTCTGCAGAATTTACTTGTCTTTTTTGACCCTG
ACAAAATCCTTGAGAAGCTAGTCTGCCTATCTGAGGATGCTAATGGGCTAGATGATCCAGACTTTGAGTTCCTGAAGGAC
TCTTTTGAGTAAGTCAACTCTATCTTGTGGTCTTGTGGTTCATACCCTGCGCGGGCTTGACTGTTGGCAAATAGTTTCAG
TGAAGCGGTAGTGGAACTCACCCGAGGATCCATGATTTCGAAACTTTCATACTCTGAATCTTTCTCGATGCACCGCCTTG
TGCAGCTTGCTGTGTTTTTGCGCATATCCAAGAAGGACCGCCCAATGTACTTTGACACGGCCACGCGGTTGTTATACTAC
GGCTTTCCAAACACATGGAACGCGAGAGGACCGCACCAGGGCCATGGTTTCACCTACTGGACGACTTGCAGTGAAATCCT
GCCCCATGTCTCTTTCCTCATGGACATGTCCAAAAAGTACAATATCAAAACAGGCAACGCTGAAATCTGGGCAGAACTTA
TTTTTAGAACGGGAGCGTGAGTTGCAAGAATCTAGTCATGTTTATATACTAGTTGTTTTGATTTTGACCAGCAAAACAAC
ATAGGTACCTGTGGGAAAAGGATCAGCAGTTGCTAGCAAGAGCATTTTTCGAAACTGGCCTCAGCATCGACGACGACTCA
AACAGCCCCGTCGTGGCCCAGGCTTACCGATATCTGGGTCACATCTCGGTCGATCTCGCTCACCCTCGGGCCGGACTGGC
TGCCTACAAGCAGGCCCTCACCGTACGCGAGGCCATCGAGCTCCCGGATTCTCCCCCCATTGCCGATGTGTACGATTCCA
TCGCCTGTGCATACACAGAGGCTGGCGATATACATAACGCATTTGACTTTGTCGATCGCGCCACGGCCATTCATAACGCC
CACGACCCGTCCAAGATGTCCCGCACCCTGGCCATCCGCTCCATGGCCTGTCTGCGCGACGGTCAGGCCGACAATGCCCT
CGACGCCATCCAGCAGTGCTGGAAGCTCCAGGACATGACACAAGACCAGATCGCCACGTCCCAGTATCCTAAACACAGCG
GCGACATTGTCCTCTTGGCCCGAATCCTCTGGCTGCAAGGTGAAAGGGACAAACAGGACGGAAAAGACAAGAGGAGCGCA
GCCCGCGAGCTCGCCTCCCGGGCCATCACTATGCGCCGCGGCACCTTTGGCGAGATTGCCGGCCCCCGCGTCGCTGACGC
CATCTTTATCTTGGCTACGATGCTGCGCGACGACGGTGAGCCTGTGTTAGCGGCCCAGCTTCTGCGCGAAATTGTGTCCA
TGGCCGGTACGCAACCGATCATGCAGAGCCACAGGGCGCGGGCGCTCTGGTTCCTGGGTAACCTCATGGGTACCGCTCTA
GGCCAGGAAGAGCAGGCTGCGGCAGAGACGCACGAAAGCGCCAAGAAGGCCCGCGGCGAAATCGAGAGCCGCGAATGGCC
AGATGTGGACAGTGACGAAGGGTTTATGCGGCTGGTCTCATGGATGGTCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62