GenePrediction:GLEAN_497 Details

Name: GLEAN_497
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:172971..174100 (+ strand)
Length: 1130
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:172971..172986 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_97:173068..173365 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_97:173434..174100 (+ strand)
Length: 667
>GLEAN_497 class=GenePrediction position=GCSC_97:172971..174100 (+ strand)
ATGGCCGACTCCGTTGGTATGTCAACAATGCCGGCAAATCTCCACCCAAAAGTCCTCCTCCACACAACAGTGGCTAACGA
GTCTCCTCTTTGAACAGATCGCGTATTCGTCCATGCGCTCAACACGGTCAAGAAGATCCCCAAAACCGGGGCCGCTCGGC
CACCGTCGGCGGACCGGATGCGGCTGTATGGGCTCTACAAACAAGCCATGGAAGGAGATGTCGATGGCGTCATGGAACGG
CCAAACAGCCACTCCGGCTTGACGGCCGACGAGCTGCGACGAGAACAGGACAAGTGGGACGCCTGGAACGCAGAACGTGG
GCTCAGCCGAACCGAGGCCAAGCGACGCTACATCGAGACGCTCATAGAGACAATGCATACTTATGCAACAACACCGTGGG
TCTGCCCCCTGCTCCTATGGCGGTATCCGTACCCAACTGACAGTCGACAATCTGAATCTGCAGAACGGCGGCTGAGCTTG
TTGCCGAGCTCGAGTTCGTCTGGAACCAGATCAAGGACAACCACACGCCCAGCTCGGCCGGCTCCTATCGGAAAGACACG
CTGTACGGAGCGCCCGGCGACAGCGCCCGTCGCCGTGCAAGCACGGCACAATCTCAAGGACGGGCCAGTGGCGGCTACGG
TGGCTATTTCGACGGTGGTGGCAACATGACGGTGGACACTCTGGACGGCCCGCTGAGAGTGCTGAGCCCGATGAGCGAAG
AAGACGAGGTCGAGCGTGAGGACCGCATCAGGCTCATTGAAGAAGAGCTGGAGGTGGCCGAGGGGGGTGGTGTCGTCGGT
GCTGAGGCTTCTGGCCAGCCGTTCGGCCGCGGAGACAAGTGGTTCCGAAAGATGGAGAGAGCCATGGTGAAGCTGGCTAC
CGAGGTAGCAGCGCTCCGCGAAAACATAACGGCCGGACGAGAGTTCCGTTCGCGTCGAGAGAAGGCCCCGCTGGCGTGGT
TTGGGTGGGCTTTTTGGGTGCTGTGCAAGCACCTGGCCGCAGACGTGTGTCTTCTCATCTTTGTCTTGCTGTGGTTCAGA
CGGCGGAAGGACCGGAGGGTGGAAGACCATGTCCGAGGTGTTCTTGCGGTTTTGCGCGAATACGCGAGAAAGTTCTTGCC
GTCCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62