GenePrediction:GLEAN_4988 Details

Name: GLEAN_4988
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:207833..206570 (- strand)
Length: 1264
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:207833..207628 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_89:207482..207378 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_89:207293..206570 (- strand)
Length: 724
>GLEAN_4988 class=GenePrediction position=GCSC_89:207833..206570 (- strand)
ATGTCTGTCTCCAAGGCACCGCAGCAGCAGCCCAGCCTGCTCTGGCGGACTGCGTCCACGGCCGTCATGGCCACCACCGG
CTTGATCTGCCGCACCTTTCTCTACGGTCTCAGCAGCGTTGAGGTCCACGGCCTGGACAAGTTCCTGGCTCTGCTGGACT
CACGGCGCGACATTGAGGCGCGGCAGCGGGGGCTCATCACTGGTGGGTAGTTTCCATCTGTCTCATCCTGTTTAATCTTC
TGCTGACATGGACAAGTCTGCAACCACGTATCTGTGTAGGTGTCGTGTCTTCAGGCACATAATGTACCACACCCACACAA
TCACCCACACACACAACTGACCGGCCTGCAGCCTCGACGACCCGCTCATCTGGGGCGTCCTGCCGTGGCGGTACACCCTG
GACCACCGGAACCTGCGATGGGGCCTCGGTGCCCACGACATCTGCTACAAGAACAGGTGAGTGTCTCGGATTCTGGTCAT
GGCCTCGATCATCTCTGCTCATACAGCTGCCGGCAGCCTGCTGGGCCACTTCTTCTACAGTGGCCAGACGCTGCCAACAC
ACCGCCTGAACCACTCACCGCTGGGCGGTCTCTTCCAGCCGACCATTGAGCAGGCCGTGGGCGTGCTCTCGCTGCCGTCA
TCGACGCCGACGACGACGACAACAACGACAAAAATGTCCGCCACCGCCATGGCGCCCTTCTTTTCGACCAACGGGGTCGA
TCGCTGGCCATCGCCGGCCTCGTTCGCTTGCAACCGACCCGGTTGGGTGCACATCTTCCCCGAGGGCGCCGTGCACCAAC
AACGCGACCGCGGACTCCGCTACTTCCGTTGGGGCATCGCCCGGCTGATTCTTGAGAGCGAGCCAGCCCCCGAGGTCGTG
CCCATGTTCATCGACGGACCTGACCGCGTCATGCCCGAGGACCGCGAGTTTCCCCGCTTCCTGCCGCGTGTCGGCCAGCA
TATCCGCGTCGTTTTTGGCGACGCCCTCGGCTCCGACGCCTTTGCCGAGGAACGTGCGCGCTGGCGCAAGCTCGTGGCTG
CCGGCGGTGCCGACGCCCCCTCGGATTCCTCCACCGAGTCTCCCGCTGCCGCCCTCCGCCGAGAGGTCGCCATGCGCGTC
CGCGACGAGGTCCTCAAGCTGCGTCGCCAGCTCGGTTACCCCGACGAAGACCCTGCCCTCGGTCTCGCCGAGACCTGGGC
CCGCGAACCCCATTTGAAGCGTTATCGCAGCCATATCGATGACAGCCTAGTCAACCAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62