GenePrediction:GLEAN_4989 Details

Name: GLEAN_4989
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:199194..197351 (- strand)
Length: 1844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:199194..199027 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_89:198945..198871 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_89:198799..197717 (- strand)
Length: 1083
Type: CDS
Source: GLEAN
Position: GCSC_89:197659..197351 (- strand)
Length: 309
>GLEAN_4989 class=GenePrediction position=GCSC_89:199194..197351 (- strand)
ATGTCGACAAACGGAGTTAGCCACGAGCAGTACAGTGCTACTGTTTCCAGTACCAACGAGACGAGCCAAAACTCCTCCTC
CGGCGGCAACCTCTCTAAAGACGAGGTTGGCTGGTACTTTGTGGAGCAGTATTACACCACACTGAGCAAATCTCCTGACA
AGCTTCATGTGAGTAGAATTTGAACTTATTCGTAAACACCCAACGTTGCAAGGCATATGCTGACAAAAATGTCCCCGCCC
CCTCATTAGCTTTTTTACGGAAAGAAGTCACAGTTCGTCTACGGGCTTGAGGCTGAGGTTTCCCCGGTCTCTGTTGGCCG
CCAGGTATGAATTTATTGCAGCTATGTTAACTACAGTGGCCTATCCCTCTTACTAATGTGTAACTTTAAATACAGGACAT
CCAGGAACGTATCCACAAGCTCGACTTCCAGGACTGCAAGGTGCGGATCTCCAACGTCGATGCTCAGGCATCCTTCGACA
ACATCGTCATCCAGGTTATCGGTGAGACTTCCAACAAAGCAGAAGAGCCCCGGAAATTCGTCCAAACCTTTGTTCTCGCC
CAGCAACCATCCGGCTACTTTGTGCTCAACGATATACTGCGCTTCATTAAGGAAGAGGAGGAGGATACTGCTGAGGTAGC
AGCCTCCGCCGAGGTTGTCGAGCCCGCAGCTGCCACTGTTGAGGCTGAGGCCGAGACAGAGCAGGAGCCTGAGGTGGAGA
CGGCCGAGGTGACGGTGCCGGAGCCCGAGCTTGATGCTATTGTCGTTGACAAGAAGCTCGAGGAAGCAAGCACGGAGGTC
AAGGACTCGTCAATTACTGATGTCGCCACCCCTGCGGAATCTGTTGTGAATGTTGCCACTGCCAATTCTACCGAAAGCGT
GGCCGCACCTGCTCAGCTCCCGGACACGGAGAAGGTCGTCGAAGAAATCGCCGAGGAAGATGTAAAGAAGGTTGAGGCAC
CAAAGGAGCCCAATTCTACCCCGGCTGCTCCCAGTGCCCCCGTTGCGGCTGCTCCTGCGGAGCCTGAGAAGCCAAAGGGA
CCTCCTAAGCCGATGACATGGGCTAGCCGTGCGGCAGCTGCAGCTGGAACAACACGGCCAGCCGTGGCCATGCCGAAGCT
GGCTTCCCCTGCGTCTAGCATTAACAAGCCTGCGGTACCCGCTGCGGCACCCCCCGTGGCACCCGCTGCTGCGGCAGCTC
CGGCGGCACCGGTTTCAAAGTCGGCCTCGGAGACCCCTGTTGCTGCCGCGGCCACCCCCGTTGCGGCTGCAGCCCCTAAA
GATATCGGCGAGTGGCAGACGGCTGGTAGCGACTCTAGGCGGCAAAACCGCGCACAGTCGATTTCCGGCTCTGCCCAGGA
CAAGGATACGACTCTCGGATACGTTAAGTATGTGACGGAGAAGGTGGACGAGCCGACACTTCGCCTGCACTTGGAATCGT
TTGGACCGGTAGTGTACTTCGACATCAACCGGCTGAAGGTGAGCTTTTTTTCTCTTCCTTGACACCACGGGGTGTTTGCT
GACACAATTTTATAGAATTGTGCATTTATCGAATTTGCTTCGCCTGCTGGTTACCTGGCTGCTGTTGCTGCTAACCCGCA
CACCATCAATGGCGAGAACATTGTGGTGGAGGCACGGCGTCCTAAGGCCAGCGCCTACGGCGGAGCTAACTATAGCAACA
ACCGGGGAGGTGTGTCCGGTCGCGGTCGTGGCGGCTATGAAGGCCGTGGCGGCAACCAGGGAGGTGGTCGCGGCAATTTC
TCGGGCGGTCAGAACCGCAGCCGCGGTGGTGCTAACGGTGCTGCCCGCGGCCGTGGTGCCCCTTCTCAGGTGGCCAGCGC
CTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62