GenePrediction:GLEAN_4990 Details

Name: GLEAN_4990
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:195114..193635 (- strand)
Length: 1480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:195114..194486 (- strand)
Length: 629
Type: CDS
Source: GLEAN
Position: GCSC_89:194418..193635 (- strand)
Length: 784
>GLEAN_4990 class=GenePrediction position=GCSC_89:195114..193635 (- strand)
ATGATGATGGAGCGAACAGTGTCCCAGGAAACGCTCAGGCTAGCGGGGCCAGGATCTTCGGCAGCACCGCCGTCGCCGAC
GCTGCAACGACGCTCGTCCCTGGAGGAGGACTACTTCTACCGGCAGTTGATGACGGTGGACAAAAAGCCGAGGGAGCCGC
CACCATCGTACGAGTCAACGCTCAAGAAGATGCGGCGGGCGGAGGCGGGCGAAGCGGCACCAGCAGAGCCGGTCTCTCCA
GCCTTGGCCGTGTCGTCGACGGTGATGCGCAAGGTCAAGAGCAAGGGCAAAGAACGGCTGGACGGGCTTGTGCGCAGCAG
CAGCGCGGTCGAGGAGCTGCCAGCGTACACGTGCGACATCAACATGGAGGGCGTGTTCCAGCGCAAGATGGAGATCGAAA
ACACGACCAAGCGAGCGGCCGACCGGCGGTGGTCGCCGGTGGTGGTGAAACTGCGTGGCACGGCTCTCGAGGTGTACAGT
TGCCGCAAGGACCGCAGCTGGGTCGGACGGATGGCCCGTGGAGGGCCGGGTGTCTCGCCGGATAACCCGCCGTGGCTGCG
GCCTGGCAGCCTGGAGAAGAGCTACAACCTGACGTATGCGGACGCGGGCATAGCATCCGACTACATCAAGTAAGTCGTGT
CGGTCCTGCCTGTGCCAAGAGAGGCTGTGGCTAACGAGCACGTCCACTCCCGGCAGACGTCGTTATGTCATCCGCGTGCG
AGCCGAGACGGACCAATTCCTGCTTGCGTGCATCGAGCTGGAGACGTTTGTGCGCTGGCTGGACGCACTTTTTGCGGCAC
TCAGCATCGCGCTGCCCATTGACGAGCGCGATTTTCCGCGAGACCAGAGCATCCCGCGGCTGCAGCGAATCCGGTGGTAT
CGTGGACGTGATCGCGAGGCGGGCGCCCAGCAAGACGGTGCCCGCGAGCTGCAGGAGGCCCTCGACGGCGAGCTGCAGCG
GGCGGAAAGCCTGGGTGGAGGTGTGGAAGAGGGCAGTGGCATTAGCTTGGGCAGGATCGTCTCCCGATCGTCTGTCTTTA
CGGCCACATCGCGGCTGAGCGAGAGGACCGTTTCGGGACCGCCAGCGGCTTCGGCGGCTGCTTCGGCGGCTGCTTCTGCT
GCTGCTGCTCGTGCAGCAGCTGCTGCCCAGGCAGCTGCGGCCTTGGTGGCACCGATGGCCCCCTTGGCCACGCGACTGTC
GGCGACAGACTATCCAAACGACGCGGTCGACACGCAGACGGGCAAGTGGCAGCCGCGACACCGCTGGACGACGACGCACG
ACATGGTGTACGCCAAGCTGTGCTATGCGACGCTGCTGTTCCGCAGTCCGCGCAAGAGCAACTACATTGTCATGCGCGGC
AAGCAGTGGTTCGTCGACTGGACGACGGGCAACATGTTCCGTGTCAGCCCGCCGCGCTACGGCGAGGTCGAGCTGTTTGG
GCCCTGGCAGGTGGTCCGGACGGAGAACGCGCGGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62