GenePrediction:GLEAN_4991 Details

Name: GLEAN_4991
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:188090..186533 (- strand)
Length: 1558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:188090..187513 (- strand)
Length: 578
Type: CDS
Source: GLEAN
Position: GCSC_89:187430..186533 (- strand)
Length: 898
>GLEAN_4991 class=GenePrediction position=GCSC_89:188090..186533 (- strand)
ATGGCCTCCCGCACCTCGTATACCGCCGCCATCAACCCGGCCTTTGCCGGCAACGGCAGAAGCGGCGGACGCGGTGGCCA
GTTGCTGCTCTCGTCGTCCATCTCGTCGCTCTCCACCTCCGTGTCGTCGCGCCATGGTCATCCACGCCACCATCACAGCC
AAGCCGGCAACAGCATGTCCAAGATCTATCGCCAGGCCTCCTCGCTCTTCCTGACGCGTCGGCTGCCCGAGGCCCTGTCG
ACGCTGCTGCCGCTTCTCATTCCGCGGCCTGTCGAAACGGACGGCACCAATGACACAAACGGCACAAACGGCTCCGATGC
CCCGTCTGCAGCCGCTGTCGAACCGGCTCCGCTCGCGAGTGCGTCTCGCACCACCCGCGTCAAGGTGTGGAGCCTCTACC
TCACCGTCCTCAACGCCATCCTCGAGCTCGAGCCCGACGAGGGCAAGGAATCCTTTGGCACCCAGGAATGGCGCTCTCTC
TGCGCAAAGGTGCGCGATGGCGACATCTGGGACGAGGTCGTCCGGAACGGCTATCATGGCCAGGAAGGTGACGTTGACGC
TGATGTCGTCATCAATCTGTAAGCCTTCCTTCTCTTCTCTGTCTGACCCACTCTCCACCGTCGCTCTCGCAGCCCTGCTC
ACATCCTGTCTTCCATCCAGTGCCACGCTTTTGTTGGCACACGCGCCGTCGCAGGCCGTGAACCAGAAGCGGCTCGAGAG
CTATCTGTCCTACTCGCAGATGCCGAACCTGGACCTGTCAGGCCACTTTGACGTGCCGCCATCCCCGCGCCACCAGTCGC
GCCACCGATCGGCGACCAAGCCTACGCCCGGCACCGACACGCCCCGGGACCTCAATGCCCGCGTCAAGATCCTGGAGCTC
TACACCCTGCATGTGCTCCTCCGCAACGACGAGTGGGACTACGCCCGGGACTTTATCAGCGCCAGCCCCGTCCTGGACGA
GGAGCGCCGGGAGGCCTTTCTGCAGGCCCTGCAGAGCCTGCGCGAGGAGCAGCAGCTGGCCAGCCAGCGCGAGCAGGAGG
AGCGTGAGCAGCACCAGCAGCAGCTTGAGGACGCCCGCCGGACCCGGGCTGAAAACGAGGAGCGCGAGCAGCGCCGAATA
GAAGAGGAACGTGCTCGCCGTGAAGACGCCGCCAGCGAACACGGCTCCGTCACCCACCGTCACAAGGCCCCGTCCTATGC
TGGACGGGGCCGGTCCTCCCCATCATCACGACCGTCCACAGCAAATGGGGCCGCGTCCGCAACAGCGGCAACAGATGCTG
CTTCCGCGGCCACGCCAAAGGGCAAAGGCAAGGCCAATGCCTCCCTGGGATCACGCACCGCTCTCATCTTTCACAGCCTC
CGGACCCTCGTCGACCAGATGGGCGCCAGGTTCCAGGCAAGCCCAATGGCCCTAGTCCGTACCCTTCTGTTCATTTCTGC
GTTGCTCGTCATGTTGGGGAAGCGAAATGTTCGGGAGCGTCTGGCTCGTGTCCTGGGCAGCGGGTGGAACAAGGTCAGGG
CTACGGCCGGCATGGGTGTTAAAGTCAGTTACATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62