GenePrediction:GLEAN_4992 Details

Name: GLEAN_4992
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:184887..181196 (- strand)
Length: 3692
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:184887..184255 (- strand)
Length: 633
Type: CDS
Source: GLEAN
Position: GCSC_89:184201..184133 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_89:184058..183630 (- strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_89:183378..183282 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_89:183069..181196 (- strand)
Length: 1874
>GLEAN_4992 class=GenePrediction position=GCSC_89:184887..181196 (- strand)
ATGTCCCTGGGAGAGGTAGAAGACACGGGACCGCAACCGAATGACGACCCCCGAGACGACGAGCCGGCGATCAAGCGGGC
CAAGGTGGCTGATGAGCGAGGCGACGACGAAGGGCCGGCGCGCAACGGGCGCCAAGACGAAACCGGCCGAGACGACATCC
ACAGTCGTCGCCATAGCCATGGCCGAAACGGCAGATCAGGCCCTGGGTCGGTGGGCAGCCAGGGCCTCAACTACTCCGAT
CACGAAGGGGGAGAGCAACGGGGAAGCTGGGATCGCAGAGAGTCTACGAACCGCGAGGAACGCAGGGAACGCAACGAACA
AGGCCGGTCACACAGCAGGCGTCCTTCTCCTGTAGCCGAGCCGAGCGCACGGGATGCACCGAACCGGCGCAAGGTCAGTG
TCTCGCAGGAAGAGCGCAAGCGCGGACAACGGCTCTTTGGCGGCCTTCTCAGCGCACTCAGTCAGCCTGCAAAGCGCTCA
GCGCCACAGGCGCATCGGAGGCAGGAACCAGAGCAGCAGCAGCAGCAGCCAGAGAAGCGAGAAAGCAGAGAAGAGAAGCA
GCAACAGGCTGAGCGCGTTGCCAAGCTGGCGACGGCACGCAAGATCGAACAGATCAAGTTTGACGAAAGAGTGGTGGGTG
ACCGGTACTCCCATCCTTTGCGCATGGTCCGAGCTAACACTGGAAGATGCTCGCTCGCCATTCGAATCTGCTTGCCCTCG
CGCGCAACCTGCAGACCAGGAGCGAGCCGAAACTAGTGAGTGCTACCACAGTCATGTCCTATCTCCAGCCGAATGGACAG
TCTGGGACCGTACGCTGACACGATTACAGTACTACCGTCCGTGGGAGCTTAGCAAACATCAGGAGCAGATCATTGAGGAT
CAGATACTAGCCGCAGAAGAAAATATTGAGCGTGAAACAAGCGAGTTTGCACGCCAGAAGCGAGAGAGACTTGCAGTGCT
GGGCGTCGTGGCATCGAGCCCACCACATGAGCCTGAGGTCACGACCAGCGCTGCTAAGACGGAAGTGGAGGACAAGGCTA
CGGCAGATGGACCTACCACGGCTGCCAGCAAGGAGCCCGAGGACCAAGAACCAGCTCCGCCTCTGCCATCAGTAATGTCT
CCACTACATCCTGTATCGGACGAGAAGGACGATCAGGCAGAGGAGGCGGAGGAGCCCGAACATCATGACGATCAGACACA
CCGGCACGACCATGACGACAGAGACAGGGATATCATGGTGGAGACAGAGGAGGACACGGTGATCTACTGAGAGCCCATAA
GTTTTTACATTTTGATATCTAGTGCTTTTCTGATGACCCTATGTTGTCGTGTAATGGGATGTTGCCTTCCACTTGCAGGC
AGGCCATACGATATCAGGGCGTACAGGATACACCTAATAGAAATCAGAGCCTGTGGCGAGGCCGTTGGTCTTTTTGACCG
AAATAGAAGATAAACGACTTTGCATCGTAGGCAGACGAGAGACTGGTAACTTGGACGAGGACGTGCTAGGCGCTGATTTT
CGCGCTGTGCGAATTGCTTAGCAGCCTGAAGCGGGCTGCTCCGGCCGGGCGATCTGCTGAACGCGGGGGCGTGTGGCCTC
TGCCTGGTACGAAACGCTGCTGCCTCGCGCCCGAGCTGTAGTGGCGCATGATCCGACGCGCCCCATTCGTCGCTTCCCTC
CGCATTCTGCTGAAAAGCAGGGCAGGCACGCGTCGTCTGTCAGCCACGTCCGTCAGACAAGTCCGATTTTGACCCACGAC
GATCAAGGCGATTGATCACTTGTCTGGCTTTCTTTTTGCCGGTGTGCCACGTTTCTAGTGGCGGCCGTGGTTTCAGGCCT
CTACTCCGCGGCGACTGGGAGCCCTGTCTCTGATTTTAGTGGGGGTCATTCTGAGAGGCTACCAGTCAGCCTACTGACCG
ATAGATCCGCCATCGACCTTCTCTACACCAGCAACACCATCAACGTCACGAGCAGTCCCGACCCCCATATTCATTCCGAT
AAAATCGCGGGTCTTTCCCCCAGAAATGCAGCGGCAGGCAAGCCAGAGGACGAACTCGATCTGCCCGTGTCGTCCATAAG
AAGGGACAGCTTCTGTCAAGCTCGCACCCCTAATACCTACAATACGCCCATCAGGCGTACCAGCAAGACACATATTCCCA
TCATGGCCATCATAGACCGGCTGCGGGGCATCCTGCCGGCCAAGGCAGCGGAGGAGCGCGAGTATGCGCCGCTGAATGGG
GGCCCGCTGGCGCTCGTGGGCGAGGACGAAAACGGTTACGCGACTTCGTCGCTGCTGGAAGGCTCGGGCGAAGACATCGA
GACAGAGAACGAGGCTGTCTTTTCGTGGATGGAGTACAGCATCTTCGCCATCATCGGCGTGGCCATGCTCTGGGCGTGGA
ACATGTTCTTAGCGGCGGCGCCATACTTCCAGATGCGCTTCGCTACCGACCCGTGGGCCCTAGCCAACTTCCAGTCGACC
ATCACATCCGTCTCGACTGGGACCAATCTAGCAGCTATGCTGGTGCTGACCAACATTCAGTACTCGGCCTCATACCCGTT
TCGTATCAACTCGGCGCTGGTCATCAACGTTGCCGTGTTCGGCCTGCTGACGGCCTCGACTTCGCTCTTCCTGCACGTCT
CGCCGACCGTCTACCTCGCCTTCTTGCTGCTCATGGTCTCGGCTGCGGCCTGGGCCTGCGGCCTCATCCAGAACGGCGCC
TTTGCCTTTGCCGCGTCGTTTGGTCGCCCCGAGTACACTCAGGCGATCATGGCCGGACAGGCCGTTGCCGGCGTGCTGCC
GCCCATTGCCCAGATGGTTTCTGTGCTCGCCTTTGCGCCGTCTGGAGGGCCACCCGGCGGCCCACCACCGAAGTTGGTAT
CAGCCACCAGCAACGACGTTATCAGCAACCAGGACGCCATCGCGGCCGCCGGCACGTCGGCATTCTTCTACTTCTTGACG
GCAGTCACCATCTCTGTCGTGGCCCTTGCCGCCTTCCAGCCGCTGGTCAGACGCCACCACCGGCTCGTGGAGGCCCGCAT
GGTCGAGGCGCTCTCGGAGAGCATGGCATCGATCGAAGAGGCTGAGCGGACTGCACGCAAGGTCATCGGCATGAAGGCGC
TATTTCGCAAGCTGCATTGGGTCGCGCTGACCGTGTTTATGTGCTTCCTCATCACCATGTTCTTTCCCGTCTTCACGCCC
AAGGTGCTGTCTGTCACGACGCCGCGGTCACCGGCATCGAGTACCAGCCCCGACGCAGCGCAGCCCCCGCCGATGTCGCA
GCAGCCGAGACTGTTGCAGCCGTCGGCCTTCATCCCACTCGCCTTCTTCTTCTGGAACCTGGGCGACCTGCTGGGCCGCA
TGTCAACTATGCTCCCGATGGCGACGAGGCTGCGCCAGCGGCCCGTGGTGCTCTTCGTGCCGAGTGTGGCGCGGCTGGCC
TTCTTGCCGCTGTACTTGTTGTGCAATCTGGGAGGACGCGGTGCCTCGGTTAACAGCGATCTGTTCTACCTCTTTTGTGT
GCAGCTGCCATTTGGCCTGAGCAGTGGCTTCCTCAGCTCCAGCGCCATGATGGCGGCCGGCGAGTGGGTCAGCGACGGCG
AGCAGGAGGCGGCCGGTGGTTTCATGGGTCTCTGTCTGGTGGCCGGCCTGACAGTCGGCAGCCTGCTCAGCTTTACGGTT
GCGCGGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62