GenePrediction:GLEAN_4993 Details

Name: GLEAN_4993
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:177017..170661 (- strand)
Length: 6357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:177017..176751 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_89:176278..174687 (- strand)
Length: 1592
Type: CDS
Source: GLEAN
Position: GCSC_89:174162..172270 (- strand)
Length: 1893
Type: CDS
Source: GLEAN
Position: GCSC_89:172197..171962 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_89:171902..170870 (- strand)
Length: 1033
Type: CDS
Source: GLEAN
Position: GCSC_89:170814..170661 (- strand)
Length: 154
>GLEAN_4993 class=GenePrediction position=GCSC_89:177017..170661 (- strand)
ATGGCCTTCAACTTTAACTGGTCGCCGCTTGCGGCCGATGCCAGCTTCTACCAGCGCGCCCGGGACCTCCTGACCACTGC
CCTGAACAAGACTCCGAAGCCTCCCATTATCGTCGACGACATCATTGTCACCGAATTCAATCTAGGCTCCGTCCCTCCCG
ACCTCGAAATCCTCGAGATCGGCGATATCGCCGCCGACCGGTTCCGCGGCATCTTCAAAATGTGCTATACGGGCGATGCC
TTTCTCACCCTCAAAACACGCGTACAGGTTAGTGATATTCTGCGTTCTCTGTAACGCTGCTTGTCGTCCGCCTCCGCAAC
ACCCACTCTCATGTGCTGCGTCTTCGGCCCCTCTCTTCCGTGGGCAGTGGGTCCGAGCGGCGGTGAACACACGATAACGT
CTTTCTATTCCATTTTTGGCAACTTTCTCTCCACTCTTGTCTCTGTTTCTGTTATCGTGCCGGCTGCCGTCGGGCAATCA
CACCTTGGTGCATTTTCTTCGTCCATAAACGCCCTTGGTCGCATCTCACGGTGCTTAGTCTCATTGTTTCCGAAAGAAGA
TGTTTGGAACCCCGCTGTTTGTTTATTTTCGTTTCTCTTAGCTCTTGCAATTCTGCCGTGAAAGGTGTTGCCAATATCTC
TTTCTCGGTATTTTCTTACACACCTCATTTCCCATTTTTACTACACCTCAATGTCATTGCATGTCATAGTTGCTAACATG
CGTTGTCCTGTAACAATAGGCCAATCCGCTAAACACATATCTCTCCTCCAAACCATCCTTCACCTCTCCAGAACCACTCG
CCGCGGCATCCAGCTTGACGATCCCACTCCAAATCACATTATCCGAAATCAAACTCTCCGCCTTCATTATTGTCGTTTTT
TCAAAACAGAAGGGGTTGACTCTTGTATTTCGCAATGACCCCCTCGAATCGCTCAAGGTCTCGTCGACCTTTGACTCCAT
TCAGTTTGTTAGGGACTACCTGCAACGGACGATCGAGGGCAAACTCCGCGACCTGATGATGAATGAGCTGCCGGCCATCA
TTCACCGCCTGTCACTTCAGCTGTGGTCGCCCGACCAGGCACCCAAGGAGGACAGCAACGCTACCGCCGATGATGACGGT
GAGGTGCGCGTGAACCCGTTAGCCGACGTGCCGCCAGATGCGGTGGACGCGTATGGCAACCCCATCGACGCTGGCGAGAT
ATCGTCACTGTCGACCACAGGCAGCCCAGAAACCCAGTCGCTCTTCTCGCAGAAGAACCTTGTGCGGCTGGCGGCGCTTA
CCAACTCACACCGGACACTGTCGCTGTTCACCCCTGGCATTCGGGAAGTTGTCTTTCGGGCATGGACACGGCCAGTTGAT
CGGCAGGATGCCAACGGCAGCGGCGGAACCGGCAGCAGCAGCAGTCCGCCGTTCTCGACACCGAATCTGGCGCGGTACAA
CTCGTATACGGCAGCAGCAACATCCACGACCGCCACTACTACCACATATACATTCTCCGACACGGGCAGCCAAGTTCACG
GTCATTTACCTGCACGGCCATCAATGGTCAGCATGGGCTCCGTGACTACAGGACTGTCCCTGGGTGCCAATCACAGCCGA
CATAGCAAGGCCTATGGCGGCGCGCGCAAGAAGAAGACGCGCGTGGTCAATCTGCGCAAGAGCAGCGACAGCAGCAGCAG
CAGCAGCAAGGCCCCCATTGGTGTCGGTGCGCCGGTCAGCGAGGTCGAGACAGGATCCGATAGCGTATCGGTGCAGGGCG
CCTTGTCGGAGCCCATTCTTCCAGCATCGATTCCCGAGGAGAATGAACTGGAAGTACAGCCAGAACTGGCGACAGGGCCC
CCGGGCAGACCAGGGCTAGCTGGGCTAGCAGAACTGGGACAGCCGGCAGGACAAGGAGTGCAGGCACAGACAGCGGCCGC
CATTGCCATCGAGCCAGTCACCAGCATTGGCGCAACGCTGGCAGCAGCCGGCCGTGCCCCGGACCAGAAGGCGCCTGAAA
CGGCAGAAGCAGCAGTGCCAAGGGCGATGGTGCCCGGGTTTATGCACGCGGGGGGCGTGCTAGAAGCGGCGCTGGCCGAC
GAAAAGCGGCGATCTCAGGCGGCGGCGGTAACAGCAGCCGCAGCATTAGCAACATCAACGCGGCCAGGCATAAGACCAGG
TACACGGTCCGGCGCACGGCCCAACGCACGGCCACCGCAGACAGCACAGAACGACTCGTCAACAGTGGTGGAGAAGGAGT
GGATTATGAAGATGGCGAGCGAGATTGCCAGGCGGGTCTACGACGAGAACCGCAAGAACCCTACCTTTTGGGACGAAGCG
CCACCTCCGGCGTACGAGGCTACGAGATAGATGAACCGTTGTATGAATTTATCAAATTGAACATTCTAAAAATTAGTGGA
TGCACGTGATACGGCGAATCGGTATACATAATTACGTAGTGCTGCGCTTGTATGGACTGTATAAAAGTACAGTGCATCGC
TCGTAGAAACACAGTATAACTCATCGCGGTCGGAGCCGTGATTATTGCTCTTAAAGGCATAACAAAAGATAAGGATTAAG
TGCCTACTAATCTATATGCCGTCATAGGCAGTTGTGAATAGGTGCGGACACATCCACTTCTTCTAGCTCGTATTCTCGGC
GGATCAGACCTCGGGGATCAGCAACTCGGCTTTCTTACTTTTCCGTAATCCTTTTCAGTCTCCCCTTTTCTGCCAATGGG
CTCGCTGTCATCGACGGTGTGACTGCTACGAGGAAAGAAAAAAAGCTTTCTCTGCGATTGCGTGGCCACATCGCAACATC
CAATCCGCCACTCCCGCTGGTATCCGGGTGCACCCCCACTGCTCTCCACAGTCAGTGACCAGTCGCGACAGCAATCAGCA
ATTAGCAATCAGCAGTTCTGCTGTTCCCGACCGACGTTGGCGCCCGCCGCGAGACGTCTTCCCGTTGCAGTGCGCCTGCG
TCCGCAGCTGGCCAGCCGGCTTTGCAGCCTTCCGACGAGCACGAGCAGCCTCGAGGCATCGACGGTAGCTAGCAGCGACA
TCCAGGAAGCGATCGGGCGACGGTGGTGCGACCGGGGTGGTGCGTGCGAGACTATGGCGCCGACGAGCGAGAAGAAGGCG
GACAGGGCGACGCTGCTGAGCTCGATCAACCCGTGGGGAGCATCTCGGCGCAACGCGTCGCCGGCGCGAGGGTCCGAGGC
CGAGACGCCGTCTGTTGGTGTGGCTAGCGGGCCAGGAGGAATCGGAGCAGTTGCGGCAGCCGGAGCGACAGGGGCAGCAA
CAGTACTGGGACTAGGCTCGACGTCGGGGCCAACGATGGGTTCTGGCGCAGCAACACCGTCAGGGGGCGTGCAGGACCAC
AGCATCAGCCCATTCTATGGACGGAGCATCCGCGAGTATCCAGCCGGATGCCCGCTGCTGAACGTGCAGTGGTTCCACGC
CGTGGACGTGCCGAAGCGCAAGGCCGAGTGGTTCAAGGGCAAGAAGGCGGTGGCCAAGGACGGCAAACCACCGCCACGGC
CGAAAAAGTACGTGGCTTTCTCGATATCTGACAGCCGATCGATCGAGACGGCGTACCAGGCGGTGCTGGAAAAGATGGAG
GACAGCCGACGGACGTCGGGAGCGCAGGCGTGGGGTACGCGCCGGCGGTCGCCATCCTCACGACGGGACACGGCCGATTC
GGGCGACCTGGGCGATATGGGGATGGAGGGAAGCGATGTTGACGGACTGGGACGCGGACAGACCGGCCAGCCTGGTTCCC
GTCACGGCCGCGGCGTCAAAGTGCCGGTCAACGAGGATTTCTTGTTCGACGTGAATGTTGAGGACCGCGAGCTGACGCCG
GTCTACTGGCTCGGACCGGTCTATGACGTGCGGCGCGGCAGCTGGTTCTATCAGGAGGGCTCGACGCTGCGGCCGTGTGA
GGAGAACTTGGCGGCACAGCTGGAGGAGGGCTACCTGAAGGTGCGGCCGTGGCAATATGCGAGCGAGAGCTTGACTGAAG
ATGCGGGCGGTCCTGGAGGCTCCAGTAGCTCTGGTGGCTCTGGCGGTCCGGGGAGTTCTGCATCTACGCCTCCTCTAACC
TCTGCCACTACGTCTACGACGGCTGGCGACTCCTCGCAGCTGCAGACGCACCGGTTGTTTGGGCAGTACATGAACCATGT
GGCCACATATCAAGACGCGACGACGGCCTGGCTGTCGACGGACGGGATGCTGTCGTGGGTGACGTCGACCGTGTACGAGC
GCTTTTCGGGCGGTGGCTTCATGAGCGGCGTCAAGCTGGTGCGTGGGTACTCGGAGCCAAAGAAGGCCAAGGAAGCCAAG
GAGGCCAAAGAGACCAAGGAGACCAAGGACGCAAAGGACGGCAAAGAGAAGCAGCAGCAGCAGCAGCCGACCGGCGGGAA
TGCAACCGACGAAAAGAGGGCCAAGGCGCTCAAGAGGCGGTCGGCGCCGCCCAGCATACAGTCGGAGCGATCGGACGGCG
ACATTGGCGGCGGCGACGATGCAGAGGCGGTGTCTGAGGTGCAGTTCCGAGGCAAGCAGCTGCTGTCATCTTTGATGGGA
GGCGGCGGAAAGAGCAGCCGCAGCAACAGCAGCGCGAACGTGCCAGAGGCACAAGAAGAGGAGATCCGCAAGCGGGAGGA
AAAGGAGATCCAGGATGACTACAACGGGCAGAGTGGAGAGACGCAGGGTCGCGAGATCGAACATCTTGTCCTGGTGACTC
ACGGAATCGGACAACTACTGGGAATTCGGTGAGTCATCTTCATGATGCTGACATAATACGTTATACGGTATACGCTACAC
GCATACACTAACACGTCCAGCATGGAGAGCCTAGACTTCATCCACGACGTCAACATGCTGCGCAAGACGCTTAAGGCAGT
GTACGCGGGCTCACCCAGTCTGCGGGCGCTGAACTCGGAGCTGCCGGGCGGTCCAGGCAACTGTCGCATCCAGGTGCTAC
CAGTGTGCTGGCGTCACATCTTGGACTTTCCCAAGCGTAACGAGGGACGGCAGCAGACGCAGGACCTCGGTGACATGAAC
GAGGAGGAAGATTCATGTAAGTGTGTGGTGGCTCGCTGTTTTTGCCTTTTTGAGACGCTGTCTGACATGCACAAGATCCG
GCCCTGGAGGATATCACGATTGAGGGGATGGCGTTTGCGCGGTCGCTAATCTCAGATCTGGCGCTGGACGTGCTGCTGTT
CCAGAGCTCCTACCGCGACCAGATCTCGGAGATTGTGGTGCGGGAGGCGAACCGGATCTACCGGCTGTTCCGTGAGCGCA
ACCCGGGCTTCAAGGGCACGGTGCACGCCGTCGGACACTCGCTCGGCTCAGCCATTCTGTTTGACATATTCTGTCGGCAG
CGGGATGACCGGACAGTAGCGCAGTCGAGGCCTGGCAGTGGCAGTTCCAAGCAAGCCCGGGACCTGAGCCTTGCGTTTGA
CGTTGAGGACTTTTACTGTCTGGGCTCACCGGTGGGCCTATTCCAGATGCTGGAGGGTCGGACCATTGCGGCACGGCCTG
AAAGCAGCGATGGGGGAACAAAAGGAGGAGGAAAAGGACGCACAGCGTTTGTGGACCTCACGTTGAACGAGTCGGATGCT
GAGCCGCGGGTGGTGTCATCGCCGCGGGTGTCACAGCTGTTCAACGTGTTCCACCCGTCGGACCCGATCAGCTACCGGCT
GGAACCGCTGATCTCACCGCCCATGGCCAGCCTCAAGCCGCAGGTGCTGCCCTACACCAAGCGCGGCCTCTTTGGCAGCG
TGGCGCCACAGGGACTGACCGGCATCGGTGCCAAGGTTGGTCAGAGCGTGTCGGGCCTGTGGTCGAGCTTGTCGGCTGGA
ATTGCGAGCAACCTGCTGAACCGCAGCCTGGGCTTCAGCCAGGAAGACGTGGCGAAGCTAGGCCAGGAGGCGGGCGGTGC
TGCTGCTGTGTCTCCCGGGGGAGATGTGGCGCTTGTCGACGGCGATGTTGAGACGTTGTACTCGCACTTTCAGAAGAAGC
GCGCCAGCCTGAAAGGCGAGGATGCGACGACAGGCAGCCACAGCAGCCAGTGGCTGGCCGAAGAGGCCAAAGCGCAGCGC
ATGCGTCGTGAGGAGGCCAAGGTGCGGGCGCTCAATCGCAACGGCCGTGTGGACTATAGCATTCAGGAGTGAGTTTGTCT
TTCTTGGATGCTGCTGTCCTTTGATTAGTATTAACCTCTTCAGGAGCGTGCTCGACTTCAATCCCATCAACACCATCGCC
TCGCACATGGCCTACTGGGCCGACGAGGACGTCAGCCACTTTATCATGTCGCAGGTGCTCTCGCACCGGGCACGACCGAC
GCGGAAGCGCAAGAACCAGCATGCGCATGAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62