GenePrediction:GLEAN_4995 Details

Name: GLEAN_4995
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:161649..159574 (- strand)
Length: 2076
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:161649..161635 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_89:161570..161286 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_89:161229..159574 (- strand)
Length: 1656
>GLEAN_4995 class=GenePrediction position=GCSC_89:161649..159574 (- strand)
ATGGATATTGACAAGGTGCGCCGAAACGCCACAGCTCTTCCAATCTAGACCGCTTGGTGACTGACAGCAGACGCGACAGA
AGTCTGAGAGGAGCCATGAGCTTGGCCTTAAGTACTTAGAGGCCAGACACCAAGAAATCATCGTGGTCAAGGAGGAAGAA
TCTCGGAAACAGAAGGTGCAAGCTGTACTTCTGCACGAGAAAAATGACCAGCTTGAGGACCAGCTGTCTCAGCTGAACTA
TCGCATGAAGACGATTTCATTCGACTACGAAGATGCGCGCATCAAGCTGGATAGCATGGAACTAAAATGCCAGGAACAAG
AAAAGCAGTTGCGCGCGCAGGTCCGCGAGCATTCTACTCTGCGGGTAACTTTGTATTCCATTGCATGTAATTCGAAAACA
GAGTTGCTGACTGAGTGCAGACGGAACTGATGTCACTCAGCAGTGTGACCCAGGACTCTACCAAGGTGTTGACAGAGAAA
CTTGCTCTGTCTCGTGAGATTTCAGTTCTGAAGCCCGAAGTGGAGCATCTGAGGTCCCAATTGGCACACCAAAAGGATGT
GCTGGCTGAGAAGCTGGCGCTCGAACGACAGCTAAACACGCTCGAGCTTGAGCTGGCTAACGAAAAACGGGCGGCACAAC
GAGCAGCTCAACGACAGGAAAGCCAGGAGAGCGAGATGGAAAAAGAGCTCCGCCAGCAGGTACAGGATCTCGAAAAGAAG
GTCGCCAGCGAGAGACGCGCCAAGGACGCGCAAATGGAGTCCAAAACCGAAATGCAACAACGGATCCAGGAGCTCGAGGC
GCAGTTGGGGCAGGAAACCCAGACAGCCGAGCAACGGATGAGCAAGGAAGGCAGCAAAGCCACCGAGAAGCTCAAGAATG
CGATAAATGATCTAGAGAGGGCGCTGGAGGGCGAGAAGCGCGAAAGCCAGCGTATCCGAAAGGAGGCCGAGACGGAATTA
TCCGAAGCACGCAGCCAAACTGAGGCTCTTGAGCAGCGAGTAGCAGACCTCAAGGCGAAGTTGCGCGAAGTCCGGGACGA
GCTCAAAGCCGCTCGTGTAGAGCTGGCAACGACCAAAGAGAGCGTGAACCACATTCCCGATATTCCCAAGAAGACGGCCA
AGACAACGACAAAGTTACAGACACAAGCGCAGCGGAAGCGGCGAGGCGCTGAACAAACCGGCCCAGAGCTCCTCCTCCAG
ACGCCCGGCATTGGCGACGAAGGGCGAATGAAGCGGCCGCTTAAGAAGAGGGGCTTTGACCGCATAGTTGCTGTTGAGAA
GTCGAACTTTTCCATCACGCCGTTCCTCAACAAGACGGCGAGCATGGCGGAAGACGACGTGGAGGCCGAGCCAGCCGGGC
CATCTGAAACAGAAGGCCTGGTGCCAGGGCCAGAATCAGACGAAGCGGCAGCATCAGCACCGGAAGACGAAGGCGAGTCA
GAGTTGCAAGATTCAATCCTGGGTACGACCGTGACGTCGTCCATAGCTCTGCCTTCTGTCGACGTCCCAGCAATCGCTGC
GGTAAAGTCGAAAAAGGCCGACGGTGGCGAAGCCCCCAAAAGACGTGGACGGCCACCCAAGGAGAAGGTGCTGGGTGAGA
TGCTGGCATTGAAGAAAATTGTGCAAGTCTCGGCGTCCAGCGGAAAGGAGAGCACGGTGGCAAGAGAAGGGCCGGCTGCA
GAGGCATCTAACGAACAGGAGAACCGGCCTCCCATCAAGGCAGCAGTGGCGAAGAAGGTGCTGGGAGCCGTAGGATCGGT
GACAACGAAAGTTGTAGCTGAGCCGGAGCCCAAGAAGAAGAAGCGGAAGATTCTGGGCGCCAGCAACAGCACCATCTTTA
ATGATGACGACGATGCAGGTGTAAAGGGTAGTGTGGTGGAAGAAGCAGTAGCAGGAGCATCCGGACCGACGGTCAAGCGC
ACAGCTAAGGCGCTAGGTGGCACGCGGCCTATGGCGACCGGAGCAGGCAAGCGGACGATGTTGGGTGGTGTTCGAAATGC
TTTTGGGGCTGTCGGTGGCGGCTTTTCACCATTGAAGAGAGACCGACGTGGAGTAAACGCAAGTTTCCTTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62