GenePrediction:GLEAN_4996 Details

Name: GLEAN_4996
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:159348..158876 (- strand)
Length: 473
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:159348..159250 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_89:159142..158876 (- strand)
Length: 267
>GLEAN_4996 class=GenePrediction position=GCSC_89:159348..158876 (- strand)
ATGTCACATGAACAGCTTCACCTGCTCCTCGCTCCAGTCCCAGAATGCCTCGCCGCCACCGCCACCTCCCTCGGACTTGG
GCTGGGCATTATGGAGAATGTCACTGCGCATGCTGAGGAAGCGGCCCCACGGGCCGACTGCTTGGATTAGCTAAGAGCGC
AACAATAGGGGTAGAGACACGCACTCCATCCACCAGACTTGTCCAGCGTGACGTCTGGCGACAGACCGGCAAACAGCTCC
GTGTAGGCGCCGTAGACGGAAGGGTACAGCATGAAGCGGACAAAGGCCTTCATGACGAGCGTATGCAAAAGGCCAGCCTT
GTTGTCAGAGTTGCGGTAGAGGTCGGAATCGAGGTTGCCGGGGTTGGCGGCGATACTAACGATGCCGTCGACACGGTGCC
GGCGAGCAAACTCGGTGCTATGCAGATAGTTTCCTGCCTTGCTGGCAGCGTACTTTGCAAGAAAGATGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62