GenePrediction:GLEAN_4997 Details

Name: GLEAN_4997
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:157559..156047 (- strand)
Length: 1513
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:157559..157266 (- strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_89:157202..157152 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_89:157092..157066 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_89:156977..156621 (- strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_89:156544..156528 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_89:156467..156419 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_89:156359..156198 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_89:156115..156047 (- strand)
Length: 69
>GLEAN_4997 class=GenePrediction position=GCSC_89:157559..156047 (- strand)
ATGTCACCGGCCATTGAGAGGCTTGGCGGCCGGCTAGCGGTGCGACTAGGCCTCACCGGCAGCCTCGGGCCTGCATACGC
ATCTTCGGTCTCCCGCCGGCCAGCAGGACTGGCTGCCCTCCCGGTGCCGGCAACCAAATGCTGTTGGCGCTGCCAAAGGC
GGCTGTTTTCCATAACCGGCGTGGTCGCCGGGTCGTCTAGCTCGCGATGGACCTCGCGCCAGGAGAAAGACATCTATGCT
CGCGAGGCCAAGGTCAGGGGTCTCAAGGGCCGTGCCGCCTTTAAGCTGCTAGAGGTGTGATATCCTCTTGCTTTCTACTT
GCCTTTTGATTGCTTTCTACGGGCTTACATCTGGCAGATGGATAGTAAATATCGCCTTTTTAGGCCTGGCCAGATGGTCG
TGGATCTCGTAAGTCTTCCTTCTCGTTCGGGCTCCTGTGGAGAATGACCTGTTAACACCTCCAAAAGGGTTATGCTCCGG
GAAGCTGGTCCCAGGTGAGTTGCCTTTCTGCACAGGACATGCTGCTCAGGCAGGAGTTTCTTTTTAACGTGCCTGCCTCG
CCTCTCCCCTCACTCCTAAAAGGTGGCCTTGGAGCGAACAAAACCGACTGGTCGAGTGCTCGGCATCGATCTCATTCCTG
CCCAGCCTCCACGCGGTGTATCGACCATCCAGGGAAACTTCCTGGCACCATCGGTGCGCGCTTTGGTCAAGGAGTACCTG
GCCACATCAAAGAAGCGGCCGATCGCCAGAAATCGCGAGTCGAAGTCCGACCCCGACGCCAGAGCTCCTGACGATTTTGA
AGAGGCTACTGATATCGTGCTCGACCGCCCCAGCTACCTCCAGATAGGACAGGAGGAAGCTTTAACCAGCGCCCTCCCAT
TGACAGGCGAGGATGTGGCGCCTGTCCAAGACAGCATCGACAGCAGCCGCACGGTAGATGTGCGGCTCACCCTTTTCATA
TTTCTGTCATCTCTTCATCGTTGTGTTTCATATGTTTTTCGCTGACACCCTTTAGGTAGTTTTGAGCGACATGTCAGCGC
CCTGGCCCCAAACTTACGGCTTCTGGCTGAGAACTCTAAGTAACCCGTACAGGATGATGAACACGAGCGGCACGCCCTTC
CGCGATCACGCTGGAAGTATGGTACGAACTCCCACCTCGCCCGCTATTTCCGCTCGTATCTCCTACTGATAGTTTCCCAG
GACCTCTGCGCTGCCGCCCTCGAATTCGCCAGTGACACGCTGCGACCCGGCGGCCACTTTGTCTGCAAGTTCTACCAGGG
CGGTGAAGACAAAGCCCTGGAGACACGCCTGTTAAAGATGTTTGCCAAGGTGCACCGGGAGAAGCCCAACTCGTCAAGGA
GTGTGAGTTGTCTCTTTGATTGCGCATGCCAAAAACGAATCGTGGGAACAGGCTGATTGACACACATTGCAAATCGTTTT
ATAGGAATCGAAAGAGTCCTTTTTTGTAGCGCTAAGACGGAAAGGCAACGTCAAATGGGAGGACCTTCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62