GenePrediction:GLEAN_499 Details

Name: GLEAN_499
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:176450..179068 (+ strand)
Length: 2619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:176450..176564 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_97:176644..176667 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_97:176744..176795 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_97:176866..176880 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_97:176969..178873 (+ strand)
Length: 1905
Type: CDS
Source: GLEAN
Position: GCSC_97:178951..179068 (+ strand)
Length: 118
>GLEAN_499 class=GenePrediction position=GCSC_97:176450..179068 (+ strand)
ATGCTGCGGCAGGCTATTGCTCGGTCGACATGGCGGAACGGCAGACAGGCCGTCAAGGCAACCCGGGCCTTTTCGGCATC
TGTCCCTCGGCCTGCTGAGGTCGAGCTTACCGTCGGTGCGTCTGCCAATGCTTCCCGGGATATCCATGCGTGTGAGGGCG
ATTGCGAGACTAACCGGTGTGCTGTTGTTGACAGATGGCAAGAAGGTGTCCATAGAAGGTACGACGCGGCAATTGGCCGG
AGGAGAATACAATGGACGGAGAAGTGCGCGAATTGACGGACTAACACTGCTCAGCCGGCTCGGCACTGATCCAGGCCTGC
GAAAAGGCCGGGGCAACAGTCCCAAGGTAAGCAGGGTCCTTCTCTGCTGATTGCGGACACACTACTAGCAGCTAGTTGCT
AACGATGCTTGTGCAGATACTGTTACCATGAGTCCGTCTTCTCCATCTTGCTGCCGTCTGCTGTGTGCTGGCTGGTCCTT
TCTTGCCGAGAGAGCTTGCCGAACTGACGAGGCATACAGGAAGCTGATGATTGCGGGAAACTGCCGCATGTGTCTGGTGG
AGGTTGAGCGTGCGCCAAAACCGGTTGCGTCGTGCGCATGGCCTGTGCAGCCGGGCATGGTGGTCAAGACCAACTCGCCA
CTGGTGCACAAGGCTCGTGAGGGCGTGATGGAGTTCCTCTTGTCCAATCACCCGCTCGACTGCCCGATCTGCGACCAGGG
TGGCGAGTGCGACCTGCAGGACCAGTCGATGCGGTACGGGGCCGACCGGGGCCGGTTCCACGAAGTGGGCGGCAAGCGTG
CGGTCGAGGACAAGAACGTGGGTCCGCTGATCAAGACGTCGATGAACCGGTGCATCCACTGCACGCGATGTGTCCGCTTT
GCCAACGACATTGCCGGAATGCCGGAGCTAGGTTCGGCGGGCCGCGGCAACGACATCCAGATCGGCACATACCTGGAGAA
GAACCTAGACTCGGAGCTGTCGGCTAACGTGATCGACCTCTGCCCGGTGGGCGCACTGACGTCGAAGCCGTACGCGTTCA
AGGCACGACCGTGGGAGCTGCAGCACACTGAGTCGATCGATGTGCTAGACGGTCTCGGTTCCAACATCCGGATTGACTCG
CGCGGGCTGGAGGTGATGCGGGTGCTGCCGCGGCTCAACGACGACGTGAACGAGGAGTGGATCAACGACAAGACACGATT
TGCCTGTGACGGGCTCAAGACACAGCGACTGACGATTCCGCTGGTGCGGCGGGACGGCCGGTTCGAGCCGGCTTCGTGGG
AGCAGGCGCTGACGGAAGTGGCTACAGGCTTCAACAAGGCAGCGCCAACGGGCAACGAGTTCAAGGTGGTGGCGGGCGAG
CTTGTGGAGGTGGAGTCGCTGGTGGCGATCAAGGACCTGGCCAACCGGCTGGGGTCGGACAACCTGACGCTGGACACGCC
GACGGGTCATCTGCCGGTGGCACACGGCGTGGACGTGCGGTCCAACTACGTTTTCAACTCGAAGATTGGGGGCATCGAGG
AGGCGGACGCGATCCTGCTGGTGGGCAGCAACCCGCGGCACGAGGCGGCGGTGCTGAACGCGCGGATTCGGAAGCAGTGG
CTGCGGTCAGACCTGGAGATCGGCGTGGTGGGTGAGACGTTTGAGTCGACGTTTGAGTTTGAGCACCTGGGCAGCGACTT
TGCGGCGCTGAAGAAGGCGCTGGCAGGACCGTTTGGCAAGAAGCTGCAGGCAGCGAAGCGGCCGATGATCATTGTGGGCT
CGGGCGTGACGGACCATGCAGACGCGAAAGCGTTCTACGAGCTGGTCGGCAGCTTTGTGGAGAAGCATGCGGCCAACTTC
CAGACGGCAGAGTGGAACGGCTTCAACATTTTGCAGCGGGCAGCCTCGCGAGCGGGCGCATACGAGGTCGGCTTTGTGGC
GCCGTCGCCGGCGGTGGTGGAGACGAAGGCCAAATTTGTGTGGCTGCTGGGTGCGGACGAGATCGCGGAGGCGGACATCC
CCAAGGACGCCTTTGTGGTGTACCAGGGGCACCACGGCGACCGCGGTGCCCAGCTGGCGGACGTGGTGCTGCCGGGAGCG
GCCTATACGGAGAAGTCGGGCACGTACGTCAACACGGAGGGTCGGGTGCAGCTGACGCGGCCGGCGACGGGTCTGCCGGG
TGCAGCGCGGACGGACTGGAAGATCATCCGGGCGGCGAGCGAGTTTTTGAACGCGCCGCTGGCGTACGACGACTTGGCGG
TGTTGCGGGAGCGGATGGCCGAGATCAGCCCGGCACTGGCAGCGTACGACGTGGTCGAGCCGGTGGCGTTGAAACATCTC
AGCAAGGTGCAGCTGGTGGACCAGAACAAGGGCACCAAGGCGACGGGAACGCCGTTGAAGAAGGTGGTGGACAACTTTTA
CTTTACCGATGCGATTTCAAGGAGGTGGGTGTTTTTCTTTCCTTTTTGTCTTGATCGTCTTCTTCTTCTTCTTCTCCTCC
TTTTCTTCGCTAACAATCCAGCTCACCAACGATGGCGCGCTGCTCTGCTGCCAAGGCGACGGGCAACCCAAAGACCAGCT
TCATGGCCCCCGGCATGGGCGAGGACAAGCCGCTCGGCCAGGTCGCTTACGGGGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62