GenePrediction:GLEAN_5009 Details

Name: GLEAN_5009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:360879..360278 (- strand)
Length: 602
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:360879..360524 (- strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_142:360347..360278 (- strand)
Length: 70
>GLEAN_5009 class=GenePrediction position=GCSC_142:360879..360278 (- strand)
ATGCCGGCCATCACCCTTTATGATATCTCAATCACGACGTTCCTTAAGTCTCTTAAAACCCTTAACCACATCCTCGAGAA
GGCAGAGAGCCATGCTAAGGGGTGTGGTAAGGACCCTGATGCTTATGCCACAGTCGCTCTGACCGTTGATATGAAGCCTC
TCAGTTTCCAGGTTCAGGTTGTGTCCAACACTATCAAGAAGTCAGTCTGGCGATTGACTGGTATTGATCCCGGCAATTGG
CCTGATGATGAATCTACCATTATGGGCCTCAAAGCCCGCGTAAAAAAGACGGCGGAGCTCTTACAGAAAATTGATCCGAA
GTCTTTGGAAGGAAAAGACGATACTATGGTAGAGCTGTAAGTGACCTAACATCATATTGTCTATTTTTTGCAATCCCAAG
AGATAAGTTTAGAAAGCTGATGGATGCATGGTATTGTACAACAGGCAAATGGGTGGTCCCGGAGCTCTGAGTCTTCCTAG
TAAGGCGTACGTGCTGAATTATGCCCTTCCGAATGTTTTCTTTCATTTACAGACAACGTATGCAATTTTACGCTCTCACG
GTGTCCCCCTTGGAAAATCAGACTATCTTGGGGGATTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62