GenePrediction:GLEAN_500 Details

Name: GLEAN_500
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:180997..187055 (+ strand)
Length: 6059
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:180997..181703 (+ strand)
Length: 707
Type: CDS
Source: GLEAN
Position: GCSC_97:181762..182793 (+ strand)
Length: 1032
Type: CDS
Source: GLEAN
Position: GCSC_97:182849..182953 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_97:183583..183710 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_97:183775..183813 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_97:183873..183990 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_97:184054..184150 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_97:184268..186600 (+ strand)
Length: 2333
Type: CDS
Source: GLEAN
Position: GCSC_97:186647..187055 (+ strand)
Length: 409
>GLEAN_500 class=GenePrediction position=GCSC_97:180997..187055 (+ strand)
ATGCGTCAGGCGTCTGTCAGGGCTCTCCGGACGACCTGCCAGTACGTGTCCCGTGGGCTGTCTCGTGCCGGCCGTCGCTC
TGCCCTCTCGCTTTCGTGGACGCAGCACGCGCAGCAGCACCTCAGCCATCTCAGCCGCAGCAGCCTGCAGCGGCCGCGCT
GGCTGTCCACCGCACCGGTCAAGTCCTCGGGCGAGCCGCTGCGGTCCTCGATGCACATCCGGCGTCTCTCGCTGGTCGCC
GTGTCCGGCCTCGTCGGCTACGGGGCCTACTACACCTTCCAGGGCGACCACAACGGCAGCAGCCCGGCCGTCTTCTCGAC
CAAGGCGACCACAGCGACTACAGCAACAACAGCAGGCGAAAACGCACAGACGACGCGCAACGTGCTCGTGATCAGGGCCA
ACGAGCTCAGCACCGGCACGCTGGTCGGCGACGGACCGATCTCCAAGATGACCGACGACAGTGGACAGCGGGTGATCGAG
ATGCTGGACCCCGACCAGGCCACGCAGCGGCTGCGCCGGAACGAGGAGTCGTACGCGGTCAATCGGGGCAAGGGCGTGCT
GCGCTACGACCTGGTGCAGCTGGCGAGCAACGACCCGATCGAGGACGACCACGCGGAGAAGATCGTGGAGGTGCCAGAGA
AGAGCGGGGACATTGGCGGCGCGAACACATCCGACTGGATGTTCTGGGGGGTCTTTGACGGACATTCGTACGTGAGAGGA
AGTTGAAGAAGCCGAAGCGAGAAAGAGACGATGCTGACTACACAGAGGCTGGACAACGTCAGCTAAGCTCCGCCAGACCC
TCATCAGCTACGTGGCGCGGGAGCTGAACGAGACGTACAAGGCAGCAGTGTCGGCCGAGGGTCCACCAGCGGACGCGATC
GAGGGTGCGATCAAGGTCGGGTTCACGCGGCTGGACGACGAGATCGTCAACAAGAGCGCACAAAAGGTGCTGGGTCAGGC
GTCCAAGTCGGTGGCGGCGGAGCTGCTGGCACCGGCACTGTCGGGCTCGTGCGCGCTGCTATCCTTCTACGACAGTCGGT
CGAAGCTGCTGCGAGTAGCCTGCACGGGCGACTCACGGGCCGTGTTGGGCCGACGGACGGCGACGGGCAAGTGGACGGCG
ACGGCGCTGTCGGTCGACCAGACGGGCAACAACGCAGATGAGGCGGCACGGCTGCGCAAGTTGCACCCGGGCGAAGAGCA
TGTGGTGCGCAACGGGCGCGTGCTGGGCGGCCTGGAGCCGACGCGGGCGTTTGGCGATGCCAGCTACAAGTGGACACGCG
AGGTGTCGGACCGGCTGCGCACGTCCTTCTTTGGCCGCAGCCAGTCGCCGCTGATGCGCACACCACCCTACGTGACGGCC
GAGCCGGTGGTGACGACGACCAGGATCAAGCCGGAACAGGGTGACTTTGTCGTCATGGCCACTGACGGCCTGTGGGAGAT
GCTGACTAATGAAGAAGCCGTGGGGCTAGTAGGCAAGTGGATCGAGGCGCAGACGGCCGCCCAGACTAAGGGCAGCTCGA
AGCTGGACGCGGCCTGGGCAAAGGTTTTTGGCGCCCACAGCACCGGCAGCAGCGGGCTGCCGGTCGAGGTCGTGGGCGAG
GGCAGCGTCGGCAAGAACGGCGAGAAGACGCCGATCCGACTGCGCCAATGGGGTCTCTCGCCCGATGCCAGCGACCGGTT
CTTGGTCAAGGACGAGAATGCGGCCACGCATCTGGTGCGCAACGCACTCGGTGGTACCAACGAGGAGCAGGTGTCGGCAC
TGTTGACCCTGCCCGCGCCGTTTTCGCGGCGGTATCGGTAGGTGAAGCGAGGGGGACGAGAACGAGAGGATGAAGGCGTG
CTAACTGTCCAGCGACGATCTGACCGTCCAGGTCATCTTCTTTGGCAACGGACAGCCGACGGGCGACGTGGTCGTCAACC
AGGAGGCCACCGGGCCAGCCGCCGTCAAGGCAAGGCTGTAAGCAGCAGCACAAGGGCGAACACGTATCTCACGTTGGGCC
GGAGTAGAGTCTATGATGGTGTGAAAAGCGTTATGTAATCTTGTGTTCTTGTGTTGGCAGGCTGTGCTGGCAGGCTCGCG
GTCTGGCGGTCCTTCCCCTTTCGGCGAGCCCTGCCGTGATGTGTTGTCGCAGGTCTGCCTGGTTCCGGCCGCACTTTCCT
GTTTTTTGTGGCAACGAGCATTTTAGCGGGCGCAGAAATAGGTTACCATAGTACTATGCACCTTTGACGTCACCCCACTG
TTTTCGGTCCTTCTGTCTGCTGGCTCTCGCTCTCTGAGAGCTCGCCCGCGTTGCAGCTCCGTCTGGCCGATATCGAAACT
GTGTCCCGAACCCAACGCTCGTCTGTCGAGGTTATCTCCACCCGACGACACAGAAGCGGCCAAGCTCTCTGGCCTGCTGC
CCGGCACATCGTATCTTAGCTCGCCAACCACGACAGCCTCCACCGATAGAGGGGTGACGCTTTTCCATCAGGCTCCTCGG
TCACTTTTTCCTCTAGTCTATCTCTATCTGTCTGCTTCTGTCTCCTCCTTCCCCTCCGCCCCCCCTGTCCCTTACGGATT
CCCCATCAAGCCTGCCGACGACCGAGCACCATGGTTATCGTCGAGGGCCATGAGCACCTCACAGAGGAGGAGAAGCGTCT
GCAGGAGGACCGCCGGCGGGTGAAGTACTGGAAGAAATGGGGGCCTTATGTCTCGGAGCGCCAGTGGGCCACCGGTAGGT
CGTCGTGGAGGAGCTGCTTCTGCTCTTGCTTCTGGCCTGCGAGATGCTGACGTCCCAGTTCGCGAGGACTACAGCCCCGA
CGGTGATGCGTGGAGTCGTGAGTCCCCTCTCTTTCCCCAACCTGAGCTCGGAGCTCGGAGCTCTGACCAAGACCAGACTT
CCCCCACGACCATGCCCGCTCTCGGGCCTATCGCTGGGGCGAGGACGGCATCGCCGGCGTCTGCGACTCGCACGGACTCG
AGAACATCGCCTTTGCCTTTTGGAACGGAAAGGAGTGAGTGTCCTGCCGGCCGTCTGCCGTCTGCCTGCTGCCTGCTTTG
CTTCTGCTGACCGACAGTCCCTTCCTCAAGGAGCGGCTCTTTGGCCTGTCCAACCCCCAGGGAAACCATGGTGAGAGCAT
CAAGGAAGCTCACTTCCACCTGGACAACACACCTGTGAGTCTCTTCGTTCTTCCCGTGGCCTGTGCCCATGTACACTCGG
TGCTGACTATGTCCTCGCAGACGGTATGTTGAAACGCTGCCCTCCCATCGCACCATGAACTGACCCCGTAGCACTCCTAC
ATGAAATACCTCTACAAATACCCACAGGCGGAGTTTCCCTACGAAGACCTCGTCAAGGAGAATGGCCGCAGGACCAAGGA
GGACATGGAATACCAGATCCTCGACACCGGCGTCTTCAACGAAGACCGGTACTGGGACATCTTCATCGAGACGGCCAAGG
AGGACGATGATCCGGATGCCATCGTGTTCCGGGTGACGGCCTGGAACCGCGGTCCCGATCCGGCTCCGCTGCACATCATC
CCGCACCTCTGGTTCCGCAACACGTGGGCCTGGGGCCGCGAGAAGCCTGAGCACAAGCCGTCGATCGAGAGCGTCGACGA
GAGCACGGTCCGGTCGACCCACCCGGCGCTGGGCGAGCGCTATCTGCTGATGGCACCCTCGCCTAGCATTGGCCCTAGCG
GCCAGGACGTGATGCCCGACATGCTCTTCACCGACAACGACACCAACTTTGCCGCGCTCTACGAAGGCACCAACAAGACC
GAGTACGTCAAGGACGCCTTCCACGACTACATTGTCGACGGCAAGAAGGAGGCCGTCAACCCGGCCAAGAAGGGCACCAA
ATTCGGCGCCTGGTTCGCGTTCAACGAGGCCGGCGGCGTGGCCCCGGGCGAATGTGCCGTCGTCCGCTTCCGCTTCTCCA
AGCGCAGCGAGACCTTCCTGGACGAAGAGGAGGTTGACAACCTGATCGATGCCAAGCGCGATGAAGCCGATGATTTCTAC
TTCCGGCTCAGCCCGCTGCCCATGGCCGATGACCTGCGCAACATCCAGCGCCAGGCGCTCGCCGGCATGCTTTGGTGCAA
GCAGCACTACCTCTTCATCTGGGACCAGTGGGCCAACGGCGACCCGACGCAGCCGCCGCCGCCGCCCGACCGCAAGGCCA
TCCGCAACTCGCAGTGGAAGCACATGCACTGCGACGACATCCTGTCGATGCCCGACTCGTGGGAATACCCCTTCTTTGCC
GCCTGGGACTCCAGCTTCCACTGCATCCCGCTGGCCATGATCGACCCCGAGTTTGCCAAGAAGCAGCTGGACCTGTACAC
GCGCGAGTGGTACTGCCACCCGAACGGCCAGCTGCCGGCGTACGAGTGGAACTTTGGCGACGTCAACCCGCCGGTGCACG
CCTGGGCCACCTTTCGCGTCTTCAAGATCGAGCGCAAGCTCTACGGCCGCCAGGACCTCGACTTTCTCGAGCGCGTCTTC
CAGAAGCTGCTGATGAACTTTACCTGGTGGGTCAACCGCAAGGACATGGACGGCAAGAACGTGTTTGAGGGCGGCTTCCT
GGGCCTCGACAACATCGGCCTGTTCAACCGGTCGGAGCCGCTGCCGACGGGCGGCGTGCTGGAGCAGGCCGACAGCACGG
GGTGGATGGCCTTTTACTGTCTGTGCATGCTGAACATCTGCCTGGAGCTGGCCAAGTACCGGCGCACGTACGAAGACATG
GCGAGCAAGTTCTTTGAGCACTTTATCCTGATCAGCGACGCCATGACGTTCCGCATGGGCGAGAAGGACGAGACGTCGCT
GTGGAACGAGAAGGACGGCTTCTACTACGACGCCATCTCGTGGGGCGGCCCGTGGATCCAGCAGCTGCCGGTGCGGTCGC
TGGTCGGTCTGATCCCGATGTACGCGACGCTGACGCTGGAGCCGGAGCTGCTGAACCGGCTGCCGTCGTTCAAGCGGCGG
GTCGAGTGGTTTGTGACGAACCGCTGCGACGTGGCCGAGCGCAACATGGCGTCGATCCGTAAGCGCGGCAAGGGCGACCG
GATCCTGCTCTCGATCGTCAGCAAGGAGCGGCTGGAGTGTCTGCTGCGGCGGATGCTGGACGAGGACGAGTTCCTGAGCC
CGCACGGCGTGCGGTCGCTGTCCAAGTACCACCAGGAGCACCCGTATTCGATGAACGTGAACGGGCAGAAGTTTGCCGTC
AGCTACGTGTCGGGCGAGTCGGACAGCGGCCTGTTTGGCGGCAACAGCAACTGGCGCGGGCCCGTGTGGATGTGCGTCAA
CTACCTGCTGATCGAGGCGCTGCAGCGCTTCTACATGTTCTTTGGCGACACGCTCAAGATCGAGTGTCCGGTCGGCTCGG
GCGACTACATGCATCTCGGTCACGTGTCCGAGGAGCTGCAGCACCGCCTGCAGCACCTGTTTGCGCGGGGCGACGATGGC
CGCCGGAGCATCAACGGCGGCAGCGACCTGCTGGACTTTGATCCGCTGTGGAAGGACCATCTGTGGTACTACGAGTACTT
TGACGGCGACACGGGGCGCGGCCTGGGGGCCACGCACCAGTGCGGCTGGACAGGGCTGATTGCGCGGATGATTCACGATA
CAGGGTAAGTTGGGCTGGGCATTGATTAGTAAGCACTACTAACATCGCAGTGTCACGTGTCGTCTCCCCCAGACGCCACG
CACGCCGGCCGTCGGCATGAACCATTACTTTGACGACATCCTGCACCGCTACGACAAGGCGCCGACGCCACGGCTGCGGC
GGTCGTCAACGTCGCGGTCGATTGGCGCGCGCAGCGACTTCTTCATCGGCCACGAAGAGGGCGACGCCGAGGCCGTGATC
GACCACGACCATGACGACGATGGCCGCACGCACAGCCGGCCGATCTCGCGGCCGGGCTCCATGTTCTTCGTGGATCCGGA
GCGCGTGCGCCAGCGGTCCGAGGCCGACGTGCACCTGCATCACTACATCAGCGACCAGCTGGAGCGCATCAAGAACGAGC
GCAGCGCCAACGGCTACGGGGACGGAGACGAGTTTGAAGCGCAGGCCGAGCACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62