GenePrediction:GLEAN_5015 Details

Name: GLEAN_5015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:270949..270243 (- strand)
Length: 707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:270949..270935 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_142:270581..270393 (- strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_142:270332..270243 (- strand)
Length: 90
>GLEAN_5015 class=GenePrediction position=GCSC_142:270949..270243 (- strand)
ATGATACGCAGCGAGGTTGCTTGATACTTCTGTTGTGCCGCCTCTCGTTTTTTGTATTGTTCTTTTTTGACATTCATTGA
TCTTGTTTCACTCTGTTCTTTACCGCTATCATGGTGGCCATTGACCGCAATATGCATTCCTCACTTTTTCAACACACGTC
TAACGTCTAGTAATAGGCAGCCATGCAGATCTTCGTAAAGACCCTCACGGGCAAGACCATCACCCTTGAGGTCGAAAGCA
GCGACACAATCGACAATGTCAAGTCCAAAATTCAGGACAAAGAGGGCATCCCGCCTGATCAGCAGCGCCTGATCTTTGCC
GGAAAGCAGCTGGAGGACGGACGGACTCTCTCTGACTACAACATTCAGAAGGAGAGCACGCTCCACTTGGTGCTTCGGCT
CCGTGGCGGCGCCAAGAAGCGCAAGAAGAAGGTGTACACCACTCCCAAGAAGATCAAGCACAAGCACAAGAAGACCAAGT
TGGCTGTTCTGAAGTACTACAAAGTCGACAGTGATGGCAAGATTGAACGCCTCCGTCGCGAGTGCCCCAACGAGACTGTG
AGTATACTAGGCGCACTCTGCTAACTGTTGCCACCTCTTTTCTAACCATTGCAATAGTGTGGTGCTGGTGTATTCATGGC
TGCCATGCAGGATCGTCAATACTGTGGTCGCTGCCACCTGACGTATGTTTTTGGCGAGAAGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62