GenePrediction:GLEAN_5017 Details

Name: GLEAN_5017
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:262190..260359 (- strand)
Length: 1832
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:262190..262038 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_142:261974..260611 (- strand)
Length: 1364
Type: CDS
Source: GLEAN
Position: GCSC_142:260548..260359 (- strand)
Length: 190
>GLEAN_5017 class=GenePrediction position=GCSC_142:262190..260359 (- strand)
ATGCCTTTCGAGTCTAGGACTTCCGTGAAAATACGGGCGGCTTTTCCTCCACTGGAACCAAGTGAGCTAGCTAAGGAAGC
CGAAAAGTTCGAGTTCAACCCTTTGATCCCGCTAAAGAACTACATTGGTGCTTTGGATACTTTGTATCGTGAGGTACGTT
TGGTGTGGCTACGCGATCTACCACCATGACGATACTCATATAACTACTATTTATAGGGAAGAAATTATTTGAACGAGCGC
AACTTTGCCAAGGCGTACTTGCTTCTTTTTCGGTTCTCGATCCTCTACCTCGATAAAGTCTCCTCTCTCCCGGAAGCCCG
AACACCAAGAGGACGTACGCTACTGAAGACAACGAAGAGGAGAATAAAGGATGTGCTGGTGGAACTAGAGAACATTAAGC
CAGATCTGATTGAGGCGCGAAACCGATGGACTGCCGAACATCCTGAAGCTACTTTGAATCCAAATGCCCAATACGAAGGA
GCAAATCAAGATTTTGCTGCGCGGGATGCCGCACTTTCGTGGAATATCAAGGCACAAGCCACCCTCCTCGATGCATCATG
CCATCAGGACTTTGCAGTTGATCTTGCAACAGAGGAGCTGAGCCGAAGACAAGACACACGCCGCCATGGAGTTTCAAAAG
AGGGGGATATCGGATGGGGAGCTGGGCGTGAGCTCGGTACTGGGCGTCCACTTACGGTGGCAGAAGAATCAACCGGCTAT
GGTTATGCTGATGAGAGAGAGATGCGATGTCAGATGGAGCAAGCGAGGCGCCGGTTGGATCGTCGCGAGGAGGGCGATAT
ATTTTGGAAACAGTTGGTCGGTTTAGGAGATCGAAAAAATCAGCCTGTGCCAATGGCTTACCACTATCCATCGATTTCGA
GGTCAGCCCCTCCGCATTATGACACGGGCCAATCAGCCAGAGACCAAAAGGAAACCGGCTCCCCTCCTGGCATGATTGGA
GTGCGGCCTCAACTACCGCCAAATGAAGGTGCCTATGCCGTATCTCTGCTGGATCGATCCGCTCCACCTGTTCCGCCACG
GAGGGAGTTGGCCCCATCATCCGGAGAGCTAGTTAGACATCGCCCTTTTTCACCAACCAGTGGTTACCCATCACCATACC
CTCCGCGTCTACCACCAAAGGTAGATAGCATTGCATCACCCCCTGAAAAGGGGACAATCACTTTCCGGCCCGCTGCTTAT
TTGGAAGATGGAAAGCCTATACGACCGATATTTGTGCCCGAGGGTCTGCGCAAGGACTTCGTGCACATGGCAGCAGCAAA
CACACACAGAGGCATAGAGACGTGTGGCATTCTCTGTGGCACAAACATCAACAACGCGCTTTTTATTACGTGCCTGCTAG
TCCCTGAGCAATATGGCACCCCAGACACGTGTGAGACCACGAACGAGGCAGCAACATTTGAGTTCTTTGACGAGGAAGAC
TTACTTCAAATAGGATGGATACATACACATCCAACACAAACTTGTTTTATGAGCTCGCGTGATCTACACACGCAAGCTGG
CTACCAGATCATGATGGAAGAGAGCATCGCCATTGTGTGTTCACCCAGCCATGAGCCTTCGTGCGTATTATGGTCTCTTC
AGTGCCACCCCTAATGCGACATATTTTTTCTAACATACCTAGCTGGGGTGTATTTCGCCTTACCAAGCCACCAGGATTGC
AGCATCTTCTAGGCTGCGAGAAAACCGATACATTTCATCAGCATTCACTTCCGGCGGACGCCCTCTACGTAGATGCGAAG
AATCCTCCAGGGCATGTTTTCGTCACATCGCGTATGAAGTATCGAATACATGACCTGCGCAAGGAAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62