GenePrediction:GLEAN_5018 Details

Name: GLEAN_5018
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:250324..248955 (- strand)
Length: 1370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:250324..250280 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_142:250219..250067 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_142:249983..249919 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_142:249051..248955 (- strand)
Length: 97
>GLEAN_5018 class=GenePrediction position=GCSC_142:250324..248955 (- strand)
ATGGCCGCGGTTGTCATCTCTGCGACCAGTGCCCACGCCAACTGTGTAAGTGGCAACTTTCTGTGTCAATGTCCATCACG
ACAGTTTCAACTGATACCATGGCAGGAAGGTAACAACTGCATTCGGGCTATGATCAACACGAAGCATGTTCCGAACCCGA
CGGCCTATTGCCGGTCCTACCTTGCCACTACTGTCACCTCCACAGGAACAGCTGCCTATCCTACGGACTGGGTCAACTGC
CAGGGTGACCCTTTCCAGGTAAGCTATGCTTGCTCTTGTATTCTGAAGGTCGTCACAACAACGTCTTCTCGGCTATCCGC
TACTGGCTCCCACAAGACCAGCACATCACCATGGGAAGAAACATCGACTCCGATCAGCTTGGCCCCTACCGGATGGACAT
CATTGAGTACATATTATACAGAGTATTCTATCCCAGTCGGCACGCATATGGGTTCCTTTGAATCGTCCTCGGCTTCTTAC
CAAGAATCCTTTACATCAGAGAGCCCGACTTCTATTAGCTCAACCTCTTGCGAGAAGTATAATACTACAAGCAGCTCCAG
TGCGAGCACTTTACCGGGCAACTCGTCACCAGCTAGCTCGCCTGTCGTTAGCTTAACATCTTGCCAGGAGTTTTCTACTA
CGGTCTCAACTATTAGCACCCTACCAAAAAGCTTGCCATTAGCCAATTCAGCCTTTTCTAGCTCGATTCCGCTTGGCTCA
ACTTCTTGCGAGGAGTCTTCGGCTGTGGGTAAATCTACAGTCAGCACGTTGCCGATTAGCTTGCCTCCTGCCCTTTCTAC
CCATTGCGACGAACCCCCAACTACAACCAGCTCTTTTACAAGCTCCCCTACAAGATATGCTGCTAGCACTACATATTTTA
GCTCGTCCTTACTTAGTACGCCCTGTAAGATATCATCTGTCTCTTCGAGCACACATATGAGCTCCTCTCCTTTTAGTTCT
ACTCCGGCTTCTTTCACCAACTTTACGTTGGTTTCCACCACAACTCCTTATGTGTCAGACAGCTCAGCGCCAGTACGTTC
GGTGCCTAGTACTTCTCGCATACCTATATTCTCGTCTCGCTCGACTTCAATTTCGATGGCCACGACTTCTAAGACTGCGC
CAATGGGCAGCTCGTATAAGACACGGTCAACAAACACGTTATATTTAACCACTGTGTACACCATCAGGTTGTGCGCTCCT
ACAGTGACTAATTGTCCCGGAGGAAGTCTTGTCACTACCGATACGATTGCTGTCACGACAACTTTCTGCCCAGGTTTTAC
TATGCCAACTACAGGCGCAACAGTCACTGGTACCGTGGCACATACCAACTCCTCGACCTCGACACCAAGTGGCATCCCAG
CGACTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62