GenePrediction:GLEAN_5026 Details

Name: GLEAN_5026
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:210156..209136 (- strand)
Length: 1021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:210156..209994 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_142:209920..209136 (- strand)
Length: 785
>GLEAN_5026 class=GenePrediction position=GCSC_142:210156..209136 (- strand)
ATGACTGGGCGGCTGGACTACAGAAGCTTCCACGATGTCTTCGGAGTTGAGGGAAAGCTACCGTACGACCAGTACATCAA
CCGGGACATCGAGTCGAAGCGTAAAAGTCTCGGTGGCGTCCTCTTTGTCGACCGCGTTCTTACAGCTCTAGGTGTCAGCA
AAGGTAGGAAGGAGTAGACTTTGGCTCTACTGGCGCTTTTTATGATCTACGTTGTCCTGACACATGAACTCTGCAGTGAA
AATATACCCGCCACGCGAGGGTCGCGCGCTCCACGAGCTCTACCAGCAGATCCTCTCTTCCAAGATGTCGACCCATCACA
AGCTGTCGGCGCTATACTACCTTCTGCTAGACCACGACGATGCCATAGGCCCGCGGATGAAGCTGACGGAGAAGTTTGCG
CTTCAGACAGGCATGCCCAAGCGCTACCAGATATTCATGAGGGGGCTGTGGCACATGGACCGTCTTCAATTCCAAGTTGC
CCTAGAGTTCTTAGCACATCCATCGCTGCTCCCCGAGTTCGCTGATAACATCGTCACCGTGCTCGTCCGTCACGCCGAAG
CCGGTGACTACAGCCTAGCTTTGGCATACTACTACGCCGTCCAGCCGGTGCTAAAGACGCAGGAGGCTTTGGAACTGCTG
TTTGGCGCCATCGCGCACACCGACGTGACAGAAGGCCTAATGTTCACGCGCAAACTGCCGAACCCGGCACGGAAACAATT
GTTTGAACAGCTGGTAACTTTCGCTCTCAAGGGCAGCTCAAGCAGCACGGGTAACCTGGATGTGGCCGACCGGGCGACAG
AGCTGGTCAGCTTGCCACTGCGCAACGTCGAGGAGGCCTGGTTGCGGGAATTTCTGGTGACCGGCGAGGGCCGGAAGCTG
AAAAAAGCCAAAGACACTATGGTGATGCGGAAGATCGTGTCGGGCGACCTGGGCCTCGGCGAAGGCAAGAGCCTAGGCGG
GCCCTGGGGCATGGTGTTACAGGGCTTTCGTCACGGGACGGGCGGCCATGTAGAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62