GenePrediction:GLEAN_5027 Details

Name: GLEAN_5027
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:206420..203025 (- strand)
Length: 3396
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:206420..206368 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_142:205931..205382 (- strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_142:205299..205159 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_142:205100..205022 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_142:204955..204944 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_142:204884..204867 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_142:204479..203629 (- strand)
Length: 851
Type: CDS
Source: GLEAN
Position: GCSC_142:203399..203025 (- strand)
Length: 375
>GLEAN_5027 class=GenePrediction position=GCSC_142:206420..203025 (- strand)
ATGATACTGTTACGAGGAGGGGATGGTCTTTATGGGGCCATGGGAGCGGATCGGTGAGAGTACAGGATGCGGAGAGCATA
CAGCATAACGCGATGTTGGTGGTTACATGGCTCCTGCGCGTCGTGACAGGATCAGGAGGCTTTCTTTTCTTTTGTCTTCC
TATTCGTGGAGCTCAAGCCGGCTTCTTGGTATATATAGCAAGGCCCGAGGAGTGCTCTCTCGTCTTTCTACCCTCTTCTC
TCTTCAGACTTCACTCTCGCCAACTCCCGGTCCTGTCGCCCTCGACCTGCCTTTCTTTCGTATTTTTGTGCTCTCTACAC
TCGCTTACACCCCTCCCCCGTTCGTTTCTACCCTATATTCATTCGTTACCAAGACAGTTCCAACTCTCGCTTATATAGTG
TATCGCATATTGTTGGCCCTTCACATCCGTTCTGTCCATCAAGAGCCTTACATCTGATATGGCACATCCACGAGGCTCAC
ACCGAGCAGGTGTGCTTTTCACTCTGACTACGGCTCTGGCCGCTGTCTTGGTGTCGTCTTCGCCGGTCCTGTCTCCAGTG
TTTCCACACCGGGGTCTGCAACATATACCAGGGCATTCCTTGCCCGTCAAGTCTACACAGTTAATTTCCTCGCCGTCAAC
GAGCACAGAGACCATGGCTTCTGGGCCTACTTCTGGGTCGATGTGTCCTGCATCGACCACTGTGACGACTACCATTACGG
TTTCCACGTCTCCCACGCCATCTGCCGGAACCCCATCTGCTGTGACTTCGGCTGCCACAGCTTCGTCTGTCGGAACACCA
TCGGTTGCACCTCCGTCCACAGCTGTGTTGCCTACTACTGCGACCGCTTCGTTGTCTACACCAACAGAGTCCTCGCCAGT
GTCTACTTCATCGGTATCTGTCTCACTGGTGTCTATTCTGCCAGTATCTGGCTCGACTGCCTCTGCTTCATCGCCACTGA
CAGCCTCGCTGGCATCTTCCACAACTGTACCCACAACCGTAGCTACATCTACGGTGTCTATCCCAGCAAAGTCTGCATCG
TCGCTGTTTGCTCCGAATTCTGTGACTCCAATTGCCAACACGACATATCCCGTATCGTCTTCAACTGAATCTTCGCTGCA
GCCGTCCACAACACTGTCTGCTGCCCCGGCTTCGAACCAGACCTCCTGCAACACCGCAACTGACAGACAGTGCTGGACAT
CGGGTTTCGATATTGATACCGACTATGAAGCCAGCACTCCTGTGACTGGAGTGACCCGAACAGTATGTCCTGTTTTGTAA
TCCGCTTTCATCAGGATGAGTACGAGCTAACGTCATCTAGTACACTCTTGTTCTTTCCGAGGTTGACAACTACGTCAGCG
GCGACGGCCAGGTCAAGACAAAGGCAATGCTAGTCAATGGTACGCGTCCAATTACAATTTAAATTAACATGCGATGAGTC
TAATATGAAACTAACAAAATCACAGGAAGCTTCCCAGGTAAGCTCGGTAGCATCAATATTGCCTATTTGTTGTAGCTAAC
GAATATCTGCTTCAAGGTCCAACCGTTACAGCCAGTAAGTATTCAACTCGCTCAGACTATGGGTAGAGATAATTAAAGGC
ACCGGCTAATGCATCAGACTGGGGCGATCTTATCAATGTGACGGTCATCAACAACCTCGTGACTAACGGGCAAGTAGCTG
GTTTTTCCAATCCCAGCGATTCTTTATTCTGACCCCAAGCAGCACTTCTATTCACTGGCACGGTATTCGTCAGCTCAATA
CCAATAACGAAGACGGTACCAACGGTGTCACAGAGTGCCCTATGCCTCCAGCCGGTGGAAGCAAGACATACTCGTTTAAG
GCAACGCAATACGGTTCATCCTGGTAAGTTCAATAAGACGACTTGGGCCATTCCGCGAACATTTCATTCTGACAAGCCAA
GGTACCATTCCCACTTCTCAGATCAGTATGCCAACGGTGTTGTCGGTCCCATCGTCATTCACGGACCGGCGTCGGCGAAC
TACGACATTGATCTTGGCCCATTGATGATCTCTGACTGGTACTATGGTGCGGCTGACCAGATCCTGGAGCGTGTCAGCAG
CCTCAACAACTCGTACATTCCTGGGCTTCCTGGTGCGGCTCCTACCAGTGACAATGTCCTGTTCAACGGCCTGAATGTGA
ACGTCAACGGCACCGGCGGCGAGTATGAGAGCCTGACGCTGACACCAGGCAAAAAGCATCTGCTTCGCTTGATCAACCCA
TCTGTTGAGAACACTTTCACCGTCTCTCTCGTCGGGCACTCATTCACCATTGTCGCAACCGACTTTGTGCCTATCGAGCC
GGTCAATGTGACCAGTGTGTATATGGCTGTGGGTCAACGCTACGATGTCGTCATTGAGGCAAATCAGGCCACGAGAAGCT
ACTGGTTCAACGCGACACTCCCCAGCGGACCGTGTGGCCAGAGCTACAACTCATACCCGGCGGCCATCCTATCTTACGCT
GGAGCAAACTCGACCACTCCCACCAGCACCGGCTCTGCGCCCCCTGATCCTAGCTGTGCAGACAGTCTTGCGCTGTATAC
GCCTGTGGTTTCCCGCTCCGCAACCGTTTCGGACTTCTCGCCGGACACGGATGACACGCTGACGACCAACATTGCTTACG
AAAGCAACGGCGTGGCACGCGTCTTCTGGCCCGTCAATGGATCGCCCATCAATGTGTCCTGGAATGACCCGACGCTTGCT
TACGTTCGCGATAACAGGACGTCCCAGCTTCCTACCGACGAGAACGTCATTTCGGTGCCCAAGGCGAATGTCGTACGTTT
ACAAGAGCTAAACACTTGTGCTGGTGTTTTTTACTGACGATTGGGCAGACTACCTTTTGGTTGCTCGAGAATAACTCGTC
TATCCCGGTAAGCTTTCTCACCCTCTTGCCGTTGAGTCCTACAGTGGCTAACACACGCAGCATCCGGTCCATCTTCATGT
ACGCTTTGGTCCATTTTTTGTGGCGAAGAAACTGGTGGGGGGAATTCAGCTAACCAACCAGGGACACGATGTCATCATTC
TCGGCGCCTCAACACCACTGGCCGACCCGTTGTCAGGCAATCACACTTTGCGCTCATACAACCCGTCGACTGATGCTGCC
AAGCTTAATGGCAACAATCCTACGCGTCGTGATACCACGATGCTGCCGGCATGGGGCTGGTTGGTTGTGGCTTTTAAGAC
GAACAATCCAGGCTCGTGGCTGTTTCATTGCCATCTTGCATGGCATGTGTCTCAAGGATTTGCTGTTCAGTTCCTCGAGC
AGCTCAATGCGATCCCACAGTCTGTAGACCTTTCGGGCCTAGCGGACCAATGCCAAAACTGGAACAATTACTACCCGGCG
GAGGACCCGTTCCTGAAGACTGATTCTGGTTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62