GenePrediction:GLEAN_5028 Details

Name: GLEAN_5028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:199959..198547 (- strand)
Length: 1413
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:199959..199801 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_142:199698..198547 (- strand)
Length: 1152
>GLEAN_5028 class=GenePrediction position=GCSC_142:199959..198547 (- strand)
ATGGCTCCTAAAGCAGCTCTGCTCAGATCGGCACTGGTCGACGCGGCTCACGAAATATTCCGCGCCAACCCCGATGAACT
TACAGTCAATGCCGTGCGGAGCCATGCCGAGGATTTATTGGACCTGGAGGCTGGATTTTTCAAATCAGGCGCTTGGAAGG
TAAAAAGCAAGGAGCTAATAACTACCACAGCCGTATGTTCACCCCTTTTGTCTACAAGTCATTTTTCATTGCAAGGGTGC
TAAGAGTGTGCCACCCTGCAGAACAAGCTGCTGGAAGCTGCCGAAGGTGGGGGAGAAGAGGCTGCCGAAGTAAGCAAAGA
GGACCAACGAAACAACAGGGCAGACAAGAAGACAAAGAAGACAAAGAAGCAAGAACCAGCTCCAAAAGCCTCGGTCACCG
GACAAGACGCATTGGGCATTGACGACAGCAGTGTGAGTCCGGAAACAAAACAACCGCCCCAAAAACGAAAGCTGGCCGAG
AGAAGCATCACAGTACCGAGCCGAGAGATACAAGGAGGGCAGGACAGCGACAATGTAAAGGAAACTGCAAAAGAATGTGC
AGATAGCGGCAATGGCAGGCCGGCCGACAATGACGAGCGTAAACCTTCTACCAGGCGCAATAATGCCAAAGTCGGCGAGG
AAGCGTTGAAGCCTGGCACATCGTCACCCCTCAGCGAGGTCGATAGTGGCAATGATGTCCCAGGAATAAAACCGAAATCA
AAACAGGCTGCCACAGATTTGGTCGTTGATGCCGGCGATGTTTCCGACGGCTCAAGCACGTCCGTGCTCGACGACACTCC
TCCCCCGAAGAAAAAAATCAAGCCTTTAAAGCAGGTGCCAGCCAAGCAAGTGGCACACAAAGCCACTACAGCAACCAACT
CACCAGACGAAGTCGAGGTAAAAAAGCTACAGAGTCAGTTAGCTAAATGTGGCGTGCGCAAAATCTGGGGCATTGAGCTG
AAGCGTTTTGGTGATGACGCGAAGGCCAAGATTCGCCAGCTCAAAAGTATGCTGCACGATTTAGGCATGGATGGACGTTT
CTCTGAAGCGAAAGCTCGTGAAATTAAGGAGCGTCGCGAGCTCATGGCAGATCTAGAGGAGGTGCAGGAGATGAACCGCA
ATTGGGGCGTCAACGGCAGCGGCCGTGCATCGCGGAGCCGTATGGTCAAGACACCTAAGGAGGAAAGCTCAGACGAAGCA
GAAGAGAGGGAAGAAGGTGGCGAAGCCGAAGACAGTGACGCGGGGATGGTGGTGAGCGGCGACATCAAAAGTAGAACGGC
CGGACATGGCGATAGCAAAGAAGACGACACGGACGGGGACGGTGACGACGGGCCCAAGGTGAAGGCAAGAGGTCGCCAGT
CGGCGAGACAGGCTGACCTAGCGTTTTTGGGGTCTGACAGCGAAAGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62