GenePrediction:GLEAN_5029 Details

Name: GLEAN_5029
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:197585..195071 (- strand)
Length: 2515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:197585..197353 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_142:197277..196640 (- strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_142:196573..195828 (- strand)
Length: 746
Type: CDS
Source: GLEAN
Position: GCSC_142:195739..195071 (- strand)
Length: 669
>GLEAN_5029 class=GenePrediction position=GCSC_142:197585..195071 (- strand)
ATGCAGGCGGTAAACCGTATACGCGGCGCGTTCGCCGTACCCCGAAAGGGCGAGACGTTCGAGCTGCGTGCCGGTCTGGT
TTCACAGTATGCATACGAGCGGAAGGAAGCCATCCAGAAGACGATCATGGCCATGACTCTCGGCAAGGACGTGTCGGCGC
TGTTCCCAGACGTGCTGAAGAATATTGCGACGGCCGACCTGGACCAGAAGAAGCTGGTGTATCTGTACCTGATGTATGTG
CCCTTTTCATGCTTTTGCCCTGCATTTGTGACAAACTGTCTACTTCATCGCTGACGACTGACCGACAGGAATTATGCCAA
GTCTCACCCCGACCTTTGCATTCTCGCCGTCAATACGTTTGTGCAGGACTCTGAAGACCCCAACCCACTGATCCGCGCTC
TTGCCATCCGCACCATGGGCTGCATCCGAGTTGACAAGATGGTGGACTATATGGAGGAGCCTCTGCGCAAGACGCTGCGT
GACGAGTCGCCATACGTACGCAAGACGGCCGCTATCTGTGTGGCTAAGCTTTTCGACCTCAACCCCTCGATGTGCATCGA
TAACGGCTTCCTCGAAACGCTACAGGAGCTGATCGGCGACCCAAACCCCATGGTCGTGGCAAACTCTGTCCAGGCTCTCT
CCGAGATCAACGAGACCGCCCCCGAGACCCGCGCGCTTGTAATCACGCCCAACACGCTCAAGAAGCTGTTGATGGCGCTC
AACGAATGCACTGAGTGGGGCCGTGTCACCATCCTCAGCACTCTGGCCGATTACCCTCCCGTGGACATTAAGGAGTCGGA
GCATATCTGCGAGCGTGTCGTGCCCCAATTCCAGCACGTCAACCCGAGCGTAGTTTTAGCCGCCGTCAAAGTTGTCTTCA
TCCACATGAAGGCAGTTAACCACGAGTTGGTGCGGCAGTATCTTAAGAAGATGGCACCACCACTAGGTAAGGATATGCAT
AATATCTACTCTCTTACCGCAATTTATCCCGTCCGTCGACTAAATATGGCAGTTACTCTTGTGGCCTCGGCACCTGAGGT
GCAGTATGTCGCCCTCCGCAACATCGACCTTCTCCTTCAGGCAAAACCCGACATTCTCAGCAAAGAGATGCGCGTCTTCT
TTTGCAAGTACAATGACCCGCCCTACGTCAAGCTACAGAAGCTCGAAATTATGGTACGGATAGCCAACGACCGGAACTTT
GAGCAACTGTTGGCCGAGCTGAAGGAATACGCTCTCGAGGTAGACATGGATTTTGTGCGCCGTGCCATTAAGGCTATCGG
CCAGGTGGCCATCAAAATCGAGAACGCCAGCGAGAAGTGCGTCAACACGCTCGTCGATCTCTTGGCCACCAAGGTCAACT
ACGTCGTGCAGGAGGTGGTCGTCGTGATCAAGGACATTCTGCGCAAGTACCCGGGCTACGAAGGCGTGATCCGAACGGTC
GTGGAGCATATCGATGAACTGGATGAGCCCGACGCGCGCGGCTCGTTGATATGGATTGTCGGCGAGTATGCCGAGAAGAT
CAGCAACGCCGACGAGATTCTTTCCAGCTTTGTCGATGGCTTCATGGAAGAATTCACACAGACACAGCTTCAAATTCTCA
CGGCTGTTGTGAAGCTGTTCCTCAAAAAGCCCAGCAACAATCAGGGTCTAGTACAGAAGGTGCTGCAAATGGCTACAGTT
GAGAACGACAACGCAGACATCCGCGACCGTGCGTACGTGTACTGGCGTTTGTTGTCTGGCAACTTGGAAGATGCAAAGGT
ATGTGTCCGCCGTCTTCATTAATCCCCTTGTCATCTTACCAGACGATTCTAGCTTGTTGCGCCGTGTTTGCTTTCTAACG
AGCTAGAATATTGTCCTGTCGCAAAAACCGGCGATCACCACGACCATGACGTCGCTGCCGCCGGCACTGTTGGAACAGCT
ACTGGCAGAGTTGTCGACTTTGGCATCCGTTTACCACAAGCCGCCCGAGTCGTTTGTCGGCAAGGGTCGCTTCGGTGCCG
ACGAGATCCAGCGCGCTGCCATCCAGGAGCAGCGGCAGGACGCTGCTGATAACCCCATTGCAGCTTCGGTTGCAGCAGCC
ACTGCTGCTGCAAATGGTGGCACTGCGCCTCCGCAGAACAATATGGAGAACTTGCTGGACATTGACTTTGACGGAGCTGC
TCCGGCATCGGCTGAACAGAATTCGGCAGGTCTTAACACGCCGGAGCGCGGCAGCAGTCCAGCGACAGCGCTGGGTGGAA
TCGGTGGTGGCGCGCCACCAGCCGCTGCTGTGCCTGCTGGCGGCATCGCTGATATGATGGGGCTATTTGACGCTCCAGCG
GCAGGCCAGAACGGCTTCGGCGCCTCTTCCGCAATATCGCCACCACCGGGCGCGAATGCCTTTGGGGGTGTCAACGACAT
TATGGGTGGCTTTGGCGGGCTGGACCTGAGTGGTGGCAGTGGTGCTGCACCTTCACAAGCAACGGGAGGCCAGACTTCTA
GTGGTGGCAACGAGGATTTGTTTGGTCTTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62