GenePrediction:GLEAN_5030 Details

Name: GLEAN_5030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:191061..188488 (- strand)
Length: 2574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:191061..188834 (- strand)
Length: 2228
Type: CDS
Source: GLEAN
Position: GCSC_142:188773..188488 (- strand)
Length: 286
>GLEAN_5030 class=GenePrediction position=GCSC_142:191061..188488 (- strand)
ATGGCTACCACTGACCGAGACGTTGAAATGGCCAGCTATCACTACAGCTCCTCGCCAGAACTTTCCTCACTGCCTTCCGA
CTCTCCCTCCGATCCAGGATCCCCTTCCCGACTGGAACAGCAACGTGCCGGCCTCAGCCAAAGAAACGAAATTGTTGTCG
ACGCCACTTCCACCACGAGATTCCCGCCAACACAATCCCAACAAGCTGTGCAACTGCAACCATTCTCGGCAGAGGGTGTA
CGCCTCACAAAAGATGGCATACCACGGAAAAAGCCAGGTCGCAAGCCAGGCACAACCGTGAAGAAGGCGGGCGACGTCAC
GGCGCCTTCCGCCGGCGCTGCTGCTGCTGCTGCTGTTGGTGCTGGGTCTGTCGTTGACGCAGCTAAGCCACGACGAGTGC
GGAAACTCCAAAACTCCAATGCACCGCCAGTTTCAAGGAAGAAGCGCGCGCAGCCCTCCTCGGCACCTGTTTCGGAAGCT
GGTGCGCCGCGATCACTCTCGGCTCTCCCCTTTCCTCCAAAAATCGAGTTGACATCTATGCGCATGGATATCGACTCTCG
ATCACCCCCAGCACCTATGGCAATCCCGATCCCATCGTCAGTGCCCCAACAGCCTCGGCAGCCGCCATTGGCTGTGGTTG
GCAAACTGCCCAAACGCGATGCCATACCGAACTCGATGCAGAGCATTCTCAACTCCGACTCGCCCCCGCGTGTGTCGCCG
CCCGCAGCTCCGACAGCCACGACTCCTCTGCGCTCCCGCTACGATCCAGTGCGCTCCTCATATGATCCCGTTCGCGGGAC
TGTGGTGCCCCATCATACCTACGGCACAGGCCCGTTGGGCTCGCCGCATGGCCCAACACAGGGGCCTAATCGAGCAAGCG
CATCGCCTTCGATTGCAAGCCTCGTTGACCCTAATCCCGAACCGCATACGCGCTCTTCAGCCGCGACTTCACTGTCCCGC
CATCATTCACCGCCCAGCTACAACACGTCCGCCACAACCTCGAGTACCAACGCCCAACCTCCGTGCCGCGACAGTATCTC
TTCTCTACCTCCATCGCCGTCTGCTTCGCCTGGCATTCTCAACTCTCTGGCATCTACCTCTTCTCAATCTCAGCCTACAT
CGACAAAAGCAAAGACGGCAGCGCTAATGGCAACAAATTCCATGCCAGCATCGACATCTTTAACGGCAACGGCGACAGCA
ACAGCGCCGGCGCCTATCTACAAGTCGTCATCGTCTACGTCCACGAAAGCCGCTCTGAAGAGCGAATCTAACGGAAAACC
TCATGGTCGACCGCCACCGCCACCGCCAATCCCTGCAGCTGCCAAGTCGACCTCCAAATCTGCGTCAACCAAAACAGCCG
CTCAGAAGACATCCACCTCCAAGGCATCTGCTGCTGCTGCTACTGCTACTGAAAACGGAACGGCAAAGTTATCTGGCTCT
GTGACTACATCTATTCGAGATGTTACCATGACAGGCCTGAGCTCAACGACGGCTGCCCAGTCTACTTCGTTAGCGCCGAC
GATCAAAAAGTTCTCTCCTATATTGCAGCAGGACCGGGGCAGCAAGCAAAACAAAGCAGCGGGCACTGCATTATCACCAA
AAATGACAGGAGTTAAGGATGATGCAACACTACAACCAGTTGCTCCAGATGCTATGTCTTCGCCTGATAGCGGCAATGCC
AGTACGAACAATGAACCGGAACGCTCGATTCTAGACTTTGGCAAAGCCCGACCTGGCGAAGAGATGCAAGCCCCCTCCAT
CGTCCTCCACATTCCGCTTACCAGCGGCGAGAACAACAAGTACGTAAACTTTATGCGGATGGCTGAAGACCATTATGGCT
GGGATGCTCTGCATCCCCGGTTAGCCGCACACCGCGATCGGAAGGCACGTATCGCTGCAGCTTCAGCTGCCTTGGAAAGA
AACGGATCTGGCCGAGAGTCGGGCGACGAAATGACCGACGACATGCAATCCGGCGATGAAGGGAGCAACGACGACAATGG
TTTGATTGGGGAAAACTCGATTATTAGCATCGGGGGTGGGGGGGCTGAAGATGCCCCTGCTAAACCGGTCCGCAAGAAGC
GCATGTTCAAGGAGGACGAGTACGACAAAGACGATGACTTTGTCGACGACTCGGAGATGTTATGGGAGGAGCAGGCGGCC
GCCAGCCGCGACGGTTTCTTTGTATATTCGGGTCCGTTGGTGCCTGAAGAAGAGAAGCCAGACGAAGGGTACGTTTTTTT
CATGGTCAGCTCACTTGCACGTTTTTCAATACTGACGTCTGCTTGCAGATCTGCGCCTCCCACCAAACGGGGACGCGGTG
GACGTGGTAGCCGAGGTGGGGCTGGTCGAACGACAGCTGCACGATCCGCAGGTACTCGGAGCAATGGTACATCTGGCGCC
CGCAGCTCAGCGCCCGCACGCAAACCCAGGGCCACCAAACAGGAGAAAGAGCAGCGCGAGCGCGAAAAGGCAGACAACGA
CAAGGCAACTCATTTGGCGGCTTCAAAGGCGGCCGCAAACAACTCCATCGACCTCCGTCTATCTCTTCCGTCTGTCATGG
CTGTAGACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62