GenePrediction:GLEAN_5031 Details

Name: GLEAN_5031
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:186800..183879 (- strand)
Length: 2922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:186800..186047 (- strand)
Length: 754
Type: CDS
Source: GLEAN
Position: GCSC_142:185980..183879 (- strand)
Length: 2102
>GLEAN_5031 class=GenePrediction position=GCSC_142:186800..183879 (- strand)
ATGGCATCCGCATCGGTCAAGTCGCCGTTGATTACGGCCTCACCCGCCGCCGCGCACGGCCACAACGCCGTGGTTAGCAG
TCGAAGCAACAACAACATCGGCAGCTACTTGTCCTCTCAATACGCCAGCGACTACACTTCGCAAAATGTCGGCGGAGAGC
GCACACTGCTCAACACAATCGCCAACTCCCACGTCCCTCCGAATGCTCGTGTCGCCGGTGCAGCTGCGATACCAGCAAAG
CCACACACCTCCACGCCCTACACGTACGCTGACAACAACGAGCTGGGTGCAAAAGGCAACAGCAACGTTCACAACACCCA
CGATCCCGAGCGTGATCGGGATCCGATGCCATACATAACTGCTGGTCAGCGCCCGGGTGCGTCCACATCTGTGACAGTTG
CACCTGGTGGTGGTCGCTTCACCGAGGACTGGGATGCGGCCCAACGAGGAAGCTCACTTGTGGAAATTGCGCCCTCGGCA
GGCGGTGGTGGCGGTGGAAGCGGCAGCGGCAGCGGGAGCATCGACGGCGGCAGCACGCTGCCGCCGACACGGACTAACAC
GCTCAAGAAGAAGTCGTCCGTACGCCGGAGCGTCAGTTTGCACCGCAGTAGCAGCCGTCGGAGTATTTTGGCTGGCAGCG
TGCGCAGCTTGGCGCTGCAGAGCCACAGCGATCTCGATGAGTCTCGCAGTGCCTTCTTCTGCCCTGTCCCCACTAAAGGC
AACCCGACAGACACGCTGGCGAACCGGTTTCAAGGTGAGCTTGTCCAGCACCCGATCATGCTGCCCCCATATTCTCGCTC
GCGTTGCTAACCTCGAACAGCTTGGAGAAAAATCCTCAAAGACCTCATCTCCTACCACCGCGAGATCCACAACCATTACG
AACAGCGCGCAAAATCAGTCCAGAAGTTGTCAGTCTCGCTAAACGCCGCAGCGCTACCGCCCGGGTTTATCGTCAGCGGT
GGCCTGGACGATGCCACCCAGGTACTGCGCAACTTTCACAAGCAGGCTGTAGTGGAAGCTACAAAAGCGCGTGAGATCGA
AGACGACGTCATTTTAGCACTAACAGGTCTGCGAAGCGATCTCAACCAAAAGATCAAAGAGATTAAAAACATCTCGGGCG
ACTTCCGCAATTCCGTCAACAAAGAGATGGACGCCACCAAGAAGGCCGTCAAGAATCTGCAGGATGTCATAGGGCAAGCG
GAGCTAGACTCCTCACTGACTACTGGCCGCCAAGATCCGTATCTCCTACGCTTAGCCGTTGACCGCCAGCTCGAGCGCCA
GTTGCAGGAAGAAAACTACCTCCATCAGGCGTTTTTGAACCTCGAGAAATCTGGGCGTGAGCTAGAGGCCATTGTCGTCG
GCGAGATTCAAAAGTCCTACAACGCTTATGCGGGTATCCTGAAACGGGAGGCCGGTGCCGCATGGGCGACAGTTGATGAG
CTGCGATCAGGGCCCGTGGCGATGCCAAAGGACCAGGAGTGGATGTCATTTATCCGCGGCAACGACGAATTTGTGGATCC
AGAAACACCCATACGGTCGATCCAGCAAATTTATTACCCCGGTCAAAACCACGATTCCTGTCAAGAGATCCGGGCCGGCC
TGCTTGAGCGCAAGAGCAAGTACCTCAAGAGCTATACGGCGGGGTGGTATGTTCTCTCGCCGACACACCTTCACGAGTTC
AAGTCGGCAGATAAAATGCAGGCGCCGGTGATGTCTTTGTACCTACCAGAACAAAAGCTCGGATCACACTCGGTTGAGGC
CGCCAAATCCAGCAAGTTTGTGCTTAAAGGGCGACAGACCGGATCCATGCACCGTGGTCACACGTGGGTTTTCCGCGCTG
AGAGTTACGATACCATGATGGCCTGGTATGAAGATATCAAGGCCCTGACCGAGAAGACACCTCAGGAACGCAACGAGTAT
GCCCATGCACGTGGACTGCAACATTCGAGAAGTGTTAGCCGTGCATCACAATACACATACAGCAGCGACGGCTATGTCAA
TGAGGATGACGACGATGACGAGCCGTTTGCTAACGGCTCGCGGGCTGCCGTGACAGGCGCCTCTCTCCGAGATAATGTCG
AGGATGTCTCTTCCGGCTTCACCGCTGCAGGCCCTCAGGCTTATGCTACCGGCGCCTTTCAACAAGATCAACAAATGCAG
CGCCTTCCGCCGCCATCCGGACGCCGACCGTCTCCCGGTGGAAGATTTCCCTCTGACTTGCAAGTAAACGCACAACGAGG
CTTGGAGCTTCAGGCCTCTGGGGTCATACCACTCTCGCCTACCAGCGCCACCGGATCCGGAATCTCGGGCTCAGGGTCAG
AGCACGTGGCTATTACTGCCGCGGGCCAACTGCCACGCAAAAATCAACAGCAGTATGTTCCATGTGAAAGTGTAAACAGT
CAGACGATGTCAAATGGTATCGCCCAACGACGGCCGGAGGACACCTATCAAGTGAACGGCTATGGTGCAGCTGATCCCCA
ATTTCATCACGGACCGTCATCCCCATCCAGACCCGTCACAGCTGTTATGGGTTCCTCCGTCAACGGCGCAACTATTCCTA
GCTATGCATCTGGAAGCATGTTTACCACTAGCAGTCCATATACCGGCCCAGAGGCGGGCATCCACAGTTATTTTGGACAG
CCATCGATGTCACAGAGCCGTGAAGATGTACAGCTGCTGCCTTCCGGGGTTCAAGATGCGGAGACAATGTCAAGCCGACG
GCAGCCTACGGCTGCTGTGTCAGACAATATTGAGACAGCAACAACTACCACTAACTCGGGAGTCTCTATTGGACAGGTCA
CTGGTGGCAACGACACTAAGAAACCAAGCGTACTGTCACGCCAGGAGAGTGAGGCTGGGACCATTTCTAATTTCCATATT
CCTGGAGGATATCCACGGGCATCGACGACGGGATCCAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62