GenePrediction:GLEAN_5033 Details

Name: GLEAN_5033
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_142:175954..172298 (- strand)
Length: 3657
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_142:175954..175767 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_142:175705..175270 (- strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_142:175185..174930 (- strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_142:174875..174641 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_142:174584..174530 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_142:174459..174362 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_142:174306..174085 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_142:173440..172879 (- strand)
Length: 562
Type: CDS
Source: GLEAN
Position: GCSC_142:172816..172298 (- strand)
Length: 519
>GLEAN_5033 class=GenePrediction position=GCSC_142:175954..172298 (- strand)
ATGACGACATTCACTACGGAAGGGGCTGTCAAGGTCCCGGTCCTGGCGGACAAGGCCGGCGGGACGATCGTAGAGCGACC
ACTGACGGTGGCAGAACTCGGTGTTTCTGAAAAGCGCATGATTCGCAAGATCGACTTTGCCCTGATCCCGCTGGTTATGG
GGCTGTACATGTTCAGTTTCTTGGACCGGTAGGTCGCTCTAGACACATTATGAACAAATCCCAGACCAAGACGGCTGACC
TTCCCACAGCGTTAATATTGGCAATGCACGCCTCTACAGCCTGGAAGAAGACCTTGGCATGCACGGCCATCAATACCAGA
CCGCCGTCTCGATTCTCTTCGTCACCTACATTACCTTTGAAATTCCTAGCAACCTCGTCCTTAAGAAGTTCACCCCCAGT
CGCTGGATTGGATTCATTACCACTGCCTGGGGCATCATCGCCACCCTGACTGGCCTTGTCCATTCATACGGCGGCCTGGT
AGCCTGTCGTGTGCTGCTAGGTACTGTCGAGGCCGGTCTGTTCCCGGGCCTGAACATTTACCTGACGCTCTTTTATACGC
GCCGTGAGCTGGCAGTCCGCGTTGGCTTCTTGTTTGTGTCGGCCGCTATTGCAGGCGCGCTGGGAGGTCTGCTTGCGTAT
GGTATCGGTCACATGGACGGCCTAGACGGAAGACATGGCTGGAGTGTATGTGGATAAACTTTTCGGCAAGGCGGTCATTG
CGGACTACGAACCATTGAATGCTGCTAACATTTACATTCTTCCGTCTAGTGGATCCTGATTATAGAAGGCATTCCTAGTT
TCGTCCTCGGCATCGCCTGCTTTTTTCTCTTGCCTAATTCGCCAGAGTCAGCCTATTTCTTCACTGAGACCGAGAAGAAA
GCCGTTGCATTGCGCTGGGCTGGCGAGTATGGCCGCACCGAAAGTGCCCAAGAGTTTAGCAAGAAGGATATGTACAAGGC
ATTCACGGACTGGAAGGTCTGGGTCTTTTGTGCTGGCCAGTTCGGCGCTGACACCATGCTTTACGGTATGTAGGTGGAAA
AGGTTGGAGAGGCGAAGACAACGAGAGCTAACGTCACAGGCTTCTCAACCTTTCTACCCACCATCATCAACGGCCTGGGC
AAGTGGACTACAGCCCAGGTGCAACTGCTAACCATCCCCGTTTACTTCCTTGGCGCCGCCACCTACATGACCATGGCCGT
GCTGTCTGACCGCATACAGCAGCGCGCTATCTTTTGTATAATATTTGGTGCCATAAGCGTGGTTGGCTATGGAGTGTTGA
TCTCGGATTCGTCGGCAGGCGTGCACTATTTTGGGTATATCCAGATTTTCTCTACCATTTTGCCCCGGCTCGTGCTGACA
GTACTGCTAGTTGCTTCCTGATTGCCATGGGACTGTATGTTCTCGTGGGAATTCCTCTCGCATGGGTACGTCTTGGCACC
GAGCCCTTATTTTGGTCTCTAGAAATTGTCTGACCTTTCTCTCCTCTTCTCCCAGCTGCCCGTCAACTGCCCCCGATACG
GCAAGCGGACAACTGCGAGCGGCATGCAATTGACCTTTGGAAACGCTGCTGGCATCATGGCGCCTTTCATATAGTAGGTG
ATCTCGCGCCAAAGCCCACTGCTTTCGCATCGACTGACTGTTCTTCAGTGCTACGAAGGACAAGCCTCGTTACATCCGGG
GCCATGCTATTACCCTGTCCCTGGTGGGTTTGTCAACTTGCATTTATGTCTTTGTCTGGTGGAGCCTATCCAAAGCGAAT
CGCGCCAGAGATGCTGCAGAGCGCGAAGCCGAGGAACAGGGCCGGCCGTTACAGTTGCCTGAAGAACTGGAGGAGCTGGG
CGACGAGAGCCCGCACTTCCGGTTCCTGACGTAAGCGCAGAAACGGGAAGGTGCGAAGTATAGTTGGTGATTTCCCCTTT
GCCCGATCCGGTAGTAGAGAGTCAAAGACTGAAAGATGTGTTTATGAGCGAGGGCGATAAACGTTAACGAGCATTTATGC
ACTTCGTACTATCGTTACTCTTTAAAAACTACGCCCCCCGGCCGTTAATTGAAAAGGCCCACTTTTAGCGTGTAGCGCGC
CCTCGACGCGACCTGCTCTCCCTCTTACGTGATGTAAAAAGCTGTCGACGACATACAACAATATTCTGTAATTACAATCA
CAAATCTTGCAATCAAGCCGTCCATCGATTACAGGGAAAATCGCCATAATGGGTATCAAACAACTGTTTCAGATTGTCAA
AGAAGAGGCCCCGGATTCTGTCAAAGAAGGCGAGATAAAAAATCAGTTCGGCCGTAAAGTTGCCATTGTGAGTTTACGCA
ACGTCGCGATGCTCCCCCGGCGATAAGATGGGACACATTCGGTAACTTCGAGTGCTTGCTAATTTACTCCCAGGATGCGT
ATGAGTTTCCCTTTAGCTTCTTCGTTGGTTCTTCTCCTGCCTTTCTCATATCCCGAGACGACAACCCGGTTTCCTGGTTG
CGAACAGTGCTGATTTCAGTTTACGCATTTCCAGGTCGATGAGCATCTACTCGTTCCTGATCGCGGTGCGATCGGAAGGC
CAGATGCTAACGAGCGACGCCGGCGAGACGACATCGCATCTTATGGGCATGTTTTACCGCACGCTTCGCATGGTGGACAA
CGGCATCAAGCCGCTTTATGTGTTCGATGGTGCGCCACCAAAACTTAAGTCTGGCGAGCTCGCGCGACGATACATGCGCA
AGCAGGAGGCGACAGAAGGTCTGGAGGAAGCCAAAGAAACGGGCACGGCTGAGGATATTGAGAAGTTCTCGCGGCGGACA
GTGCGCGTGACGCGAGAGCACAACACAGAGTGTCAGCGGCTGCTCAAACTCATGGGTATTCCTTTCATAGTCGCCCCGAC
CGAGGCCGAAGCGCAGTGCGCTGAGCTGGCGCGTGCCGGCAAGGTGTATGCGGCTGCCAGCGAGGACATGGATACGCTCT
GTTTTAACACACCTATCTTGCTGAGACACCTGACTTTCAGCGAGCAGCGGAAGGAGCCTATCCAGGAGATTCACCTGGAC
AAGTTGCTGCTGGGACTGAACATGGAGCGGGAACAGGTAGTTTTCCCTCTTTCCATTGCCTACTGCCCTAACTTTCCCGA
TGCTGACTTTCCCCCCAGTTTGTCGACCTCTGCATCCTTCTGGGCTGCGACTACCTTGATCCCATTCCCAAGGTCGGCCC
CAATACAGCGCTAAAGCTGATCCGCGAACATGGCTCACTCGAAAAGGTTGTCGAGTTCATGAAAACCGACAAAAAGCAAA
AGTTTGTCATACCCGACGACTGGCCCTACGAAGATGCGCGCGAGCTCTTCTTCAAACCCGATGTGCGCTCTGCCAGCGAC
CCAGAATGCGACTTCAAATGGGAAAAGCCCGACGTCCCGGGCCTCGTTCAGTTTCTCGTAAACGAGAAGGGCTTTTCTGA
GGACCGCGTACGCTCGGCTGCCGCCCGCTTAGAAAAGCATCTTAAGGGCACACAGCAACAGCGCTTGGAAGGATTCTTCA
AGCCAGTGCCCAAGACAGAGGAAGAGCAAAAGGCGCACAAGCGCAAGCTCGAGGAGAAGAACGAGGAAAAGAAGAAGCGG
GTTAAGGAGGAGAAGAAGAAGGCTAAGGCCAAGGGGAAGCCGCGGGGTGCGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62